ID: 924226480

View in Genome Browser
Species Human (GRCh38)
Location 1:241926393-241926415
Sequence GTGGGGATGTGGAGGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924226480_924226490 24 Left 924226480 1:241926393-241926415 CCTTTTTCCCTCCACATCCCCAC No data
Right 924226490 1:241926440-241926462 ACACAGCAACTTTTGGCTTTTGG No data
924226480_924226488 17 Left 924226480 1:241926393-241926415 CCTTTTTCCCTCCACATCCCCAC No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226480_924226484 -7 Left 924226480 1:241926393-241926415 CCTTTTTCCCTCCACATCCCCAC No data
Right 924226484 1:241926409-241926431 TCCCCACAAGTCACACAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924226480 Original CRISPR GTGGGGATGTGGAGGGAAAA AGG (reversed) Intergenic
No off target data available for this crispr