ID: 924226481

View in Genome Browser
Species Human (GRCh38)
Location 1:241926400-241926422
Sequence GTGACTTGTGGGGATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924226481_924226491 27 Left 924226481 1:241926400-241926422 CCCTCCACATCCCCACAAGTCAC No data
Right 924226491 1:241926450-241926472 TTTTGGCTTTTGGCACAGCGAGG No data
924226481_924226490 17 Left 924226481 1:241926400-241926422 CCCTCCACATCCCCACAAGTCAC No data
Right 924226490 1:241926440-241926462 ACACAGCAACTTTTGGCTTTTGG No data
924226481_924226488 10 Left 924226481 1:241926400-241926422 CCCTCCACATCCCCACAAGTCAC No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924226481 Original CRISPR GTGACTTGTGGGGATGTGGA GGG (reversed) Intergenic
No off target data available for this crispr