ID: 924226482

View in Genome Browser
Species Human (GRCh38)
Location 1:241926401-241926423
Sequence TGTGACTTGTGGGGATGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924226482_924226492 30 Left 924226482 1:241926401-241926423 CCTCCACATCCCCACAAGTCACA No data
Right 924226492 1:241926454-241926476 GGCTTTTGGCACAGCGAGGCTGG No data
924226482_924226488 9 Left 924226482 1:241926401-241926423 CCTCCACATCCCCACAAGTCACA No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226482_924226491 26 Left 924226482 1:241926401-241926423 CCTCCACATCCCCACAAGTCACA No data
Right 924226491 1:241926450-241926472 TTTTGGCTTTTGGCACAGCGAGG No data
924226482_924226490 16 Left 924226482 1:241926401-241926423 CCTCCACATCCCCACAAGTCACA No data
Right 924226490 1:241926440-241926462 ACACAGCAACTTTTGGCTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924226482 Original CRISPR TGTGACTTGTGGGGATGTGG AGG (reversed) Intergenic
No off target data available for this crispr