ID: 924226486

View in Genome Browser
Species Human (GRCh38)
Location 1:241926411-241926433
Sequence TTCCTCACTGTGTGACTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924226486_924226488 -1 Left 924226486 1:241926411-241926433 CCCACAAGTCACACAGTGAGGAA No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226486_924226490 6 Left 924226486 1:241926411-241926433 CCCACAAGTCACACAGTGAGGAA No data
Right 924226490 1:241926440-241926462 ACACAGCAACTTTTGGCTTTTGG No data
924226486_924226491 16 Left 924226486 1:241926411-241926433 CCCACAAGTCACACAGTGAGGAA No data
Right 924226491 1:241926450-241926472 TTTTGGCTTTTGGCACAGCGAGG No data
924226486_924226493 21 Left 924226486 1:241926411-241926433 CCCACAAGTCACACAGTGAGGAA No data
Right 924226493 1:241926455-241926477 GCTTTTGGCACAGCGAGGCTGGG No data
924226486_924226492 20 Left 924226486 1:241926411-241926433 CCCACAAGTCACACAGTGAGGAA No data
Right 924226492 1:241926454-241926476 GGCTTTTGGCACAGCGAGGCTGG No data
924226486_924226494 22 Left 924226486 1:241926411-241926433 CCCACAAGTCACACAGTGAGGAA No data
Right 924226494 1:241926456-241926478 CTTTTGGCACAGCGAGGCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924226486 Original CRISPR TTCCTCACTGTGTGACTTGT GGG (reversed) Intergenic
No off target data available for this crispr