ID: 924226488

View in Genome Browser
Species Human (GRCh38)
Location 1:241926433-241926455
Sequence ACCAGAAACACAGCAACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924226477_924226488 23 Left 924226477 1:241926387-241926409 CCCCTTCCTTTTTCCCTCCACAT No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226479_924226488 21 Left 924226479 1:241926389-241926411 CCTTCCTTTTTCCCTCCACATCC No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226483_924226488 6 Left 924226483 1:241926404-241926426 CCACATCCCCACAAGTCACACAG No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226485_924226488 0 Left 924226485 1:241926410-241926432 CCCCACAAGTCACACAGTGAGGA No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226478_924226488 22 Left 924226478 1:241926388-241926410 CCCTTCCTTTTTCCCTCCACATC No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226487_924226488 -2 Left 924226487 1:241926412-241926434 CCACAAGTCACACAGTGAGGAAC No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226481_924226488 10 Left 924226481 1:241926400-241926422 CCCTCCACATCCCCACAAGTCAC No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226480_924226488 17 Left 924226480 1:241926393-241926415 CCTTTTTCCCTCCACATCCCCAC No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226486_924226488 -1 Left 924226486 1:241926411-241926433 CCCACAAGTCACACAGTGAGGAA No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data
924226482_924226488 9 Left 924226482 1:241926401-241926423 CCTCCACATCCCCACAAGTCACA No data
Right 924226488 1:241926433-241926455 ACCAGAAACACAGCAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924226488 Original CRISPR ACCAGAAACACAGCAACTTT TGG Intergenic
No off target data available for this crispr