ID: 924235853

View in Genome Browser
Species Human (GRCh38)
Location 1:241999095-241999117
Sequence AACTGCCTGCAGGAGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 225}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924235848_924235853 4 Left 924235848 1:241999068-241999090 CCTAACTCATTCCTCCAGCTGCT 0: 1
1: 0
2: 3
3: 21
4: 319
Right 924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 29
4: 225
924235845_924235853 18 Left 924235845 1:241999054-241999076 CCCGCAACCGGGAACCTAACTCA 0: 1
1: 0
2: 0
3: 2
4: 47
Right 924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 29
4: 225
924235850_924235853 -10 Left 924235850 1:241999082-241999104 CCAGCTGCTTCCAAACTGCCTGC 0: 1
1: 0
2: 6
3: 26
4: 331
Right 924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 29
4: 225
924235849_924235853 -7 Left 924235849 1:241999079-241999101 CCTCCAGCTGCTTCCAAACTGCC 0: 1
1: 0
2: 2
3: 58
4: 591
Right 924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 29
4: 225
924235846_924235853 17 Left 924235846 1:241999055-241999077 CCGCAACCGGGAACCTAACTCAT 0: 1
1: 0
2: 0
3: 2
4: 42
Right 924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 29
4: 225
924235847_924235853 11 Left 924235847 1:241999061-241999083 CCGGGAACCTAACTCATTCCTCC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG 0: 1
1: 0
2: 2
3: 29
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924235853 Original CRISPR AACTGCCTGCAGGAGCCTGA AGG Intergenic
900211025 1:1455964-1455986 ACCTGCCTGCAGGTGTCTGGGGG + Intronic
900216851 1:1486283-1486305 ACCTGCCTGCAGGTGTCTGGGGG + Intronic
900223932 1:1524012-1524034 ACCTGCCTGCAGGTGTCTGGGGG + Intronic
900777277 1:4594552-4594574 AGGTGCCTGCAGAGGCCTGATGG - Intergenic
902359528 1:15934850-15934872 CATAGCCTGCAGGAGCTTGAGGG - Exonic
902480068 1:16707120-16707142 CACTGCCTGCTGGGGACTGAGGG - Intergenic
903678875 1:25083766-25083788 AACTTCCTCCAACAGCCTGAAGG + Intergenic
905293493 1:36939461-36939483 AACTGCATGCAGAAGGCAGACGG + Intronic
907459713 1:54598199-54598221 AAGATCCTGGAGGAGCCTGATGG + Intronic
908023502 1:59923009-59923031 AACTCCCTGCAGGAGTCAGAGGG + Intronic
908518887 1:64921407-64921429 AAATGTCTGTATGAGCCTGAAGG - Intronic
908574461 1:65444359-65444381 ACCTCCCTGCAGGAGCCTTTAGG + Intronic
911143590 1:94531695-94531717 AGCTTCCTGCAAGAGTCTGAAGG + Intronic
917180243 1:172288382-172288404 AACTGATAGCTGGAGCCTGATGG + Intronic
918143574 1:181737513-181737535 CACTGCCCGCAGGATCCGGAGGG + Exonic
919791055 1:201291280-201291302 AACTGCCTGGAAGGGCCTGCAGG + Intronic
920033793 1:203052659-203052681 GAGAGGCTGCAGGAGCCTGAAGG + Intronic
922169720 1:223144085-223144107 CACTGCCTGGAGGAGCTTGGCGG + Intergenic
923610783 1:235491495-235491517 TACTGCCTGTAGGAACCTCAAGG + Intronic
924223559 1:241902609-241902631 AATAGCCTGCAGGAGCCTGAAGG - Intergenic
924235853 1:241999095-241999117 AACTGCCTGCAGGAGCCTGAAGG + Intergenic
1068658437 10:59598013-59598035 AATTGCTTGGAGGATCCTGATGG - Intergenic
1068739652 10:60454388-60454410 AACTGAAGGCAGGAGCCTGAGGG - Intronic
1069747499 10:70725231-70725253 AACTGCCAGCAGGAGACTTAAGG + Intronic
1069754400 10:70764327-70764349 ACCTGGCTTCAGGAGACTGAAGG + Intergenic
1070915690 10:80153163-80153185 AAAGGCCTGCAGGAGCCAAATGG + Exonic
1071398314 10:85244798-85244820 AACTGCAGGCAAGTGCCTGATGG - Intergenic
1071498777 10:86189085-86189107 AAGTGCCAGCAGGTGCCTGTGGG - Intronic
1075102439 10:119515850-119515872 AAGTGGCTGCAGGCGCATGAAGG - Intronic
1075703487 10:124484268-124484290 AGCTGCCTGCCAGATCCTGAAGG + Exonic
1076236991 10:128871199-128871221 AGCTGCCTGTTGGAGCCTGCAGG - Intergenic
1076699790 10:132265454-132265476 CACAGCCTGGAGGAGCCTGTGGG + Intronic
1077390022 11:2296539-2296561 AAATGGCTGCAGGTCCCTGAGGG + Intronic
1078534189 11:12160207-12160229 ACCTGCCAGGAGGAGCCTGCTGG - Intronic
1079994916 11:27285950-27285972 AAGTGCCTCCAGTAGCCTGAGGG - Intergenic
1080408849 11:32004478-32004500 AAATGCCTGCAGGAGCTGGATGG - Intronic
1081677838 11:44981235-44981257 AAGTGGCTCCAGCAGCCTGAAGG + Intergenic
1083272524 11:61579645-61579667 GACTGCCTTCAGGAGCCTCAGGG + Intronic
1084087759 11:66862396-66862418 AAGTGATTGCAGGACCCTGAGGG + Intronic
1085347108 11:75775314-75775336 CAGTGCCTGCAGGGTCCTGATGG + Intronic
1086023274 11:82258521-82258543 AACAGCCTGAATGAGCTTGAAGG - Intergenic
1086502350 11:87466316-87466338 ACCTCCCTCCAGGAGCCAGAAGG - Intergenic
1087177488 11:95108871-95108893 AGCTGCCTACAGGGGCCTAAAGG - Intronic
1088063751 11:105689946-105689968 AGCTGCCAGCAGGAACTTGATGG - Intronic
1089093302 11:115896790-115896812 AAATGCCCGCAGAGGCCTGAGGG + Intergenic
1090386631 11:126361110-126361132 ACCTGTCTGCAGGGACCTGAAGG - Intronic
1091064893 11:132500455-132500477 AACTTCCAGTAGGAGCCAGAGGG + Intronic
1091298629 11:134490456-134490478 ATCTGCCTGCAGCCGCGTGAGGG - Intergenic
1092107579 12:5933266-5933288 AACTGCCTGCAGCTCCCAGAAGG + Intronic
1093278523 12:17159962-17159984 AACTGACTGCAGGACTCTGCGGG + Intergenic
1094598254 12:31884911-31884933 AAGTGCTGGCAGGAGACTGAAGG - Intergenic
1096386739 12:51199321-51199343 GCCTGCCTGCAGGATCCTGAAGG + Intronic
1096504240 12:52082574-52082596 CACTCCCAGCTGGAGCCTGATGG - Intergenic
1096896485 12:54826036-54826058 AAGTGCCAGCAGGAACCAGAGGG - Intergenic
1097221738 12:57455184-57455206 CACCCCCTGCAGGGGCCTGATGG + Intronic
1097914527 12:65006453-65006475 ACCTGACTGCAGGTGCCTGAAGG + Intergenic
1103247042 12:119466706-119466728 AACTGCCTGAAAGAGCAGGAAGG - Intronic
1103996588 12:124834140-124834162 AACAGCCAGCAGGGGCCTGAGGG + Intronic
1104501986 12:129294751-129294773 AACTGCCTGCAGGGGGGTGATGG - Intronic
1105278516 13:18949895-18949917 AACTGCCTGCAGCGGGCTGAGGG + Intergenic
1105601480 13:21892228-21892250 AGCTGCTTCCAGAAGCCTGAAGG - Intergenic
1105818087 13:24055084-24055106 TACAGCCTCCAGCAGCCTGAAGG + Intronic
1107059545 13:36142953-36142975 AACTGCCTGCTGGGGCCACATGG + Intergenic
1107768839 13:43767807-43767829 AGCAGCCGGCAGGAGCCTGAGGG + Intronic
1108067313 13:46591566-46591588 AATTGCCTGCAGGAACCTGGGGG - Intronic
1114360520 14:21967284-21967306 AACTCCCAGCTTGAGCCTGATGG + Intergenic
1116992227 14:51288548-51288570 AACTGTCTATAGGATCCTGATGG - Intergenic
1119926775 14:78502069-78502091 TAGTCCCTGCAGGAGCCTCATGG + Intronic
1120855449 14:89208036-89208058 AATTGCCTGCAGGGGTCAGAAGG - Intronic
1120898104 14:89552506-89552528 AACTCCTTGCAGGGGCCTGGAGG + Intronic
1121047576 14:90799291-90799313 AAGTGCCACCAGGACCCTGATGG - Intronic
1121472436 14:94165879-94165901 AAGTGGATGGAGGAGCCTGAAGG - Intronic
1122206748 14:100151472-100151494 ACCTGCCTGCAGGCACCTGCTGG + Intronic
1122877226 14:104673799-104673821 GGCTGTCTGCAGGAGCGTGATGG + Intergenic
1125438220 15:39671492-39671514 AACAGTCTGCAGGAGCCTTCAGG - Intronic
1125722736 15:41852972-41852994 GAGTGCCTGCAGGAGCTGGAAGG - Exonic
1126359799 15:47834762-47834784 AACTGTCTGCAGGAGTCTTTGGG - Intergenic
1127664126 15:61128416-61128438 AACTGCAAACAGGAGCCTGCTGG - Intronic
1129461145 15:75700602-75700624 AGCTGCCCCCAGGAGGCTGAGGG + Intronic
1129723685 15:77891140-77891162 AGCTGCCCCCAGGAGGCTGAGGG - Intergenic
1131753556 15:95536509-95536531 AAGTGCTTGAAGCAGCCTGATGG + Intergenic
1131967509 15:97859809-97859831 AACTTGCTGCAGGAGCAAGAGGG - Intergenic
1132299824 15:100768572-100768594 AAAAGGCTGCAGAAGCCTGAGGG + Intergenic
1133162406 16:3920714-3920736 AACTGCCTGCAGAAGGAAGAGGG - Intergenic
1134053969 16:11157577-11157599 AAGGGCCTGCAGGAGCCTTGGGG - Intronic
1135125499 16:19806160-19806182 AAAGGCCTGCAGGAGCAGGAGGG + Intronic
1136285230 16:29236704-29236726 AACTGAGTGCAGGAGGCTGTGGG + Intergenic
1139218939 16:65158882-65158904 AACAGCCTCAAGGAGCCTCAAGG + Intergenic
1139345923 16:66303769-66303791 AACTGCATCCCTGAGCCTGATGG - Intergenic
1140765706 16:78154923-78154945 AAGTGCCTGCAGTGGCCTGGCGG + Intronic
1140973086 16:80032266-80032288 AACTGCTTGCTGGAAGCTGAAGG + Intergenic
1141851800 16:86651160-86651182 TACTGGCTGCAGGATCCTGAGGG + Intergenic
1142090296 16:88206329-88206351 AACTGAGTGCAGGAGGCTGTGGG + Intergenic
1142774727 17:2128065-2128087 CACTTCCTGCAGGAGTCTGCTGG - Intronic
1143454650 17:7058616-7058638 AACTCCCTGTTGGTGCCTGAAGG + Intergenic
1143773499 17:9182948-9182970 AGCAGCGTGGAGGAGCCTGAAGG + Exonic
1143957206 17:10680243-10680265 ACCTGCCCGCTGGAGCCTGTGGG + Exonic
1144092985 17:11874387-11874409 ACCTGCCTGCTGGTGCCTGTGGG - Intronic
1146890002 17:36500828-36500850 ACCTGCCTGGATGAGCATGACGG + Exonic
1146938077 17:36824904-36824926 AACTCCCAGCTGGAGGCTGAGGG - Intergenic
1147323282 17:39658625-39658647 AGCAGCCTCCAGTAGCCTGAGGG + Intronic
1148102129 17:45098682-45098704 TGGTGCCTGCAGGAGCCAGATGG + Intronic
1148844835 17:50523518-50523540 AACTGCATGTAGGAGCATGTAGG + Intronic
1149078499 17:52626140-52626162 AGCTGCATGCATGAGCCTAATGG - Intergenic
1151344297 17:73492312-73492334 TCCTGCCTGCAGGAGCGTGCCGG - Intronic
1151419403 17:73987373-73987395 AGCTGCGTGCAGGACCCCGAGGG - Intergenic
1151430399 17:74058509-74058531 AACTTCATCCAGGACCCTGAAGG + Intergenic
1155333334 18:24740145-24740167 AAATACCTGCAGGAGACTGGCGG - Intergenic
1157427698 18:47598174-47598196 AAATGGTTTCAGGAGCCTGAGGG + Intergenic
1157559651 18:48637388-48637410 CCCTGCCTGCAGGAGCCTGTGGG + Intronic
1157595012 18:48859121-48859143 ATCTGCCAGCAGGATCCAGAGGG - Intronic
1157663143 18:49463244-49463266 AACTGCCTGCAGAAGTATGATGG + Intergenic
1157900811 18:51514993-51515015 AACAACCTGCATGAGCCTGAAGG + Intergenic
1158618838 18:59012762-59012784 GACTGCCTTCAGGACCCTAAAGG - Intergenic
1160383371 18:78477916-78477938 AAAGGGCAGCAGGAGCCTGAGGG - Intergenic
1160461459 18:79041977-79041999 CACTGCCTTCAGGAGCCTCCTGG - Intergenic
1160803094 19:979591-979613 CACTGCCTGGAGGAGCCCGCCGG + Intergenic
1160945973 19:1644270-1644292 CACAGCCTGCAGGGGCCTGGGGG + Intronic
1161551757 19:4916840-4916862 GAGTGCCTGCAGGGGCCTGACGG - Intronic
1162386545 19:10363545-10363567 AACAGCCATCAGGAGCCGGATGG + Intronic
1163114134 19:15179060-15179082 GACTGCCTGCAGGACCCAGGCGG - Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1165350826 19:35274451-35274473 AAATGCCTGCAGGGGCCTGAGGG + Intronic
1167123245 19:47531652-47531674 CACTGCCTGCACGAGGCTCAGGG - Exonic
1202714105 1_KI270714v1_random:33026-33048 CACTGCCTGCTGGGGACTGAGGG - Intergenic
926362478 2:12102834-12102856 TACGGCCTGCAGGATTCTGAGGG - Intergenic
927727468 2:25437633-25437655 AAATGCCTTCAGGACACTGAAGG + Intronic
928209818 2:29315243-29315265 AGCAGGCTGCAGGAGCCTGGAGG + Intronic
929078295 2:38096467-38096489 AATTGCCTGCAGGAGCTGCAGGG - Intronic
932082431 2:68727197-68727219 AAATGCCTGCACGAGCCAGGTGG + Intronic
934605323 2:95690781-95690803 GCCTGCCTGCAGGAGGCAGAGGG - Intergenic
935712428 2:105910998-105911020 AACGGCCTTCAGGAGCACGAGGG + Intergenic
936538780 2:113333334-113333356 GCCTGCCTGCAGGAGGCAGAGGG - Intergenic
937077433 2:119117443-119117465 ACCAGCCTGCAGGTGCCTGAGGG - Intergenic
937260497 2:120583340-120583362 AACTGCCTTCAGAACTCTGAGGG - Intergenic
937292655 2:120790870-120790892 ACCTGCCTGCAGGGCCCTGGGGG - Intronic
939054845 2:137352284-137352306 ATCTGCCTGCAGGATTCTGATGG + Intronic
940881786 2:158954023-158954045 AACTGCCAGCAGGTCCCTGTGGG + Intergenic
942990933 2:182201688-182201710 AACAGTTTGCAGCAGCCTGAAGG - Exonic
947944988 2:234093612-234093634 AACTGCCACCAGGAGATTGAGGG - Intergenic
948982098 2:241499590-241499612 CACTGCCAGCAGGAGCCCAACGG + Intronic
1168802067 20:650093-650115 AAAGGCCAGCAGGAGCCAGATGG + Intronic
1169203742 20:3728908-3728930 AGTTGCCTGCAGGAGCCTGGTGG - Intergenic
1172655071 20:36531862-36531884 CACTGCCACCAGGAGCCTGAGGG + Intergenic
1173017331 20:39237527-39237549 AACTGTCTGCAGGCACCTGCTGG - Intergenic
1173256348 20:41396377-41396399 CACAGCCAGCAGGGGCCTGATGG + Intergenic
1173459740 20:43233613-43233635 AACTGCTTTCTGGAACCTGAGGG - Intergenic
1175845198 20:62054607-62054629 ACCTGGGTGCAGGAGCCTGGTGG - Intronic
1176145520 20:63563674-63563696 AAGTGCGTGCTGGAGGCTGAAGG + Exonic
1176299919 21:5094759-5094781 CACTGCCTGCTGCAGCCAGAGGG + Intergenic
1178709051 21:34898156-34898178 AACTACCTGCATGAGCTTGGAGG + Intronic
1178953018 21:37000474-37000496 AACTGACAGCAGGTGCTTGAAGG + Intergenic
1179857103 21:44167152-44167174 CACTGCCTGCTGCAGCCAGAGGG - Intergenic
1182143518 22:27982712-27982734 CACTGCCAGCAGGAGACTGGTGG + Exonic
1183521676 22:38299279-38299301 AAAGGACTGCAAGAGCCTGACGG + Intronic
1183885422 22:40877003-40877025 GACTGACTGGAGGAGCATGAGGG - Intronic
1184515931 22:44962756-44962778 AGCTGCCTGCAGGTGCCTCACGG + Intronic
1184666628 22:45992708-45992730 AAGTGCCTGCAGGGGCCCTATGG - Intergenic
1184790079 22:46694880-46694902 TACCCCCTGCAGGGGCCTGATGG - Intronic
1185041922 22:48508502-48508524 AAGTGGCTGCAGCAGCCTCAGGG - Intronic
949206044 3:1439910-1439932 ACGTGCCTGGAGGAGCCTGGAGG + Intergenic
949846090 3:8372194-8372216 AACTAGCTGCAGGAGCTTGGTGG + Intergenic
950066506 3:10115976-10115998 GACTGTCTACGGGAGCCTGAGGG - Intronic
950543944 3:13627936-13627958 GGCTTCCTGCAGGATCCTGAAGG + Exonic
950641202 3:14349603-14349625 GACTGTCTGCAGGGGCATGAGGG + Intergenic
951923592 3:27881872-27881894 AACTCCCTGCACCAGCTTGAGGG - Intergenic
951977138 3:28524541-28524563 GACTGCCTGCAGGAGCTTCTGGG - Exonic
952646458 3:35664756-35664778 AAGTGCCTGGAGGAGGCAGAAGG + Intronic
958891689 3:99790744-99790766 ACCAGCCTGAATGAGCCTGATGG - Exonic
961620020 3:128216685-128216707 AATTGCTTGCAAGAGCCTCAGGG + Intronic
962462877 3:135630862-135630884 AACTGCCTGCGGGGGCCTCTGGG + Intergenic
962476470 3:135759513-135759535 AACTTCCTGGAGGATCCTAAAGG - Intergenic
963438118 3:145298273-145298295 ATCTGCCAGCTGGAGGCTGATGG + Intergenic
963884265 3:150562583-150562605 AACTGCCTTCAGGAGGTCGAAGG - Exonic
964939233 3:162134581-162134603 AACTGACTGCAGGAGCAGGAAGG + Intergenic
965257031 3:166426102-166426124 CACTGCCTTCAGTTGCCTGAGGG - Intergenic
966620348 3:181956354-181956376 CACTACCAGCAGAAGCCTGAGGG - Intergenic
966959760 3:184923457-184923479 AAGTGACTGCAGGAGTCTAAGGG - Intronic
967681863 3:192372844-192372866 AACTGTGGGCAGGAGCCAGATGG - Intronic
967867974 3:194205818-194205840 AACTCCCAGCAGGAGCGGGAGGG + Intergenic
968668255 4:1833450-1833472 ACCTGCATGCAGCAGCCTGTGGG - Intronic
969158831 4:5237307-5237329 AGCTGCCTGCAGGGGACTGTTGG + Intronic
969228433 4:5813928-5813950 ACCTGCCAGCAGGAGCATGATGG + Exonic
969461670 4:7332361-7332383 CACTGTCTGCAGGAGGCTGCGGG - Intronic
969856425 4:10003358-10003380 CACTGCATTCAGGAGCCTGGTGG + Intronic
970439151 4:16065159-16065181 CACTGTCTGCAGCACCCTGACGG + Intronic
976893280 4:90076514-90076536 CAGTGCCTGCAGGAGCCTCTGGG - Intergenic
981421513 4:144555634-144555656 AAATGCCCGCAGGAGCCAGGTGG + Intergenic
985634784 5:1030692-1030714 GACTGGCTGCTGCAGCCTGAGGG - Intronic
985730294 5:1543670-1543692 AAGTGTCTCCAGGAGCCTGCAGG - Intergenic
985777565 5:1852687-1852709 CACCGCCTGCAGGGGCCTGCTGG + Intergenic
986749855 5:10777138-10777160 AACTGCTTGCAGGAGCTACAGGG + Intergenic
987923677 5:24314404-24314426 CACAGCCTGCCGGAGCCTGCTGG + Intergenic
988115210 5:26878648-26878670 AAATGCATTCAGGAGCCAGATGG - Intergenic
989537032 5:42575647-42575669 AGCTGGCTCCAGCAGCCTGAGGG + Intronic
991676511 5:69094124-69094146 CCCGGCCTGCAGGAGCCCGACGG + Exonic
996478097 5:123943834-123943856 TACTGTCTGCATGAACCTGATGG - Intergenic
998070493 5:139194129-139194151 AGCTGCCTGGTGGAACCTGAAGG + Intronic
999845408 5:155474155-155474177 AACTGTCTGTAAGAGCCTGAAGG - Intergenic
1000349555 5:160342636-160342658 AACTGACAGATGGAGCCTGAGGG - Intronic
1001657174 5:173360584-173360606 TATGGCCTGCAGGATCCTGAGGG - Intergenic
1001691192 5:173633767-173633789 ACCTGCCTGAAGCAGGCTGATGG - Intergenic
1001888924 5:175322621-175322643 AACTGTGTGCAGAGGCCTGAGGG + Intergenic
1002055879 5:176597655-176597677 AACTGCCTGGAGGAGGAGGACGG + Exonic
1002079595 5:176729468-176729490 AGCTCCCAGCAGGAGCATGATGG + Intergenic
1002310603 5:178311420-178311442 AACTGGCTGCAGGGGCCTCTGGG + Intronic
1002357708 5:178644324-178644346 ATTTGCCTGCAGCAGCATGAAGG - Intergenic
1004080627 6:12389148-12389170 AACAGCCTGCAGGGCTCTGAAGG - Intergenic
1004315249 6:14581225-14581247 AACTGTCTGGAGTAACCTGAAGG + Intergenic
1005225094 6:23633720-23633742 AACTGCCATCAGGAGCTTCAAGG + Intergenic
1005438573 6:25840407-25840429 AACTGGCTCCTGCAGCCTGAGGG + Intronic
1006106080 6:31717726-31717748 AAATGCCTGCAGGGGCCACATGG - Exonic
1007848422 6:44780272-44780294 AAGTGCCTGCCTGAGCCAGAAGG - Intergenic
1012494350 6:99818268-99818290 ATATGCATGCAGGAGCCTGTAGG + Intergenic
1013422348 6:109978363-109978385 AGCTGCCTGCAGGAGGCGGCCGG - Exonic
1015695412 6:135974949-135974971 AAATGCCTCCAGGAGCCAAAAGG + Intronic
1016157767 6:140834028-140834050 ACCTGCCATCAGGTGCCTGATGG - Intergenic
1018397257 6:163387983-163388005 AGCTGCCTGCAAGACCATGAAGG + Intergenic
1018790709 6:167145586-167145608 AACAGCCAGCAGGAGCCTCGGGG - Intergenic
1019155704 6:170037595-170037617 GACTACCTGCCAGAGCCTGAGGG + Intergenic
1019947385 7:4340831-4340853 ATCTGCCAGCAGCAGCATGAAGG + Intergenic
1022518015 7:30987985-30988007 AAGGGGCTGCAGGAGCCTGGGGG + Intronic
1022665448 7:32406195-32406217 AATTCCCAGAAGGAGCCTGATGG - Intergenic
1023861995 7:44222258-44222280 TGCGGCCTGCAGCAGCCTGAGGG - Intronic
1026057128 7:66994730-66994752 AACTGCCCGCATCGGCCTGAGGG + Intronic
1027812296 7:82919330-82919352 AAAAGCCTGCAGGAGCCAGAAGG + Intronic
1028346997 7:89795396-89795418 AGCTGCTTGCAGTAGTCTGAGGG + Intergenic
1032058615 7:128704813-128704835 AACAGTCTGCAGCAGCCTGGGGG + Intergenic
1032892934 7:136219197-136219219 AACTGCCTGCAGTGTCCTGGAGG - Intergenic
1035358823 7:158296375-158296397 AACTCTCAGCAGGAGCCAGAGGG - Intronic
1035892111 8:3356782-3356804 ATCTGTCTGCAGGAGGCTGCTGG + Intronic
1038267521 8:26047947-26047969 AAGTGCCTGCGCGAGCGTGAGGG + Intergenic
1043494472 8:80785120-80785142 CACAGCCAGCAAGAGCCTGAGGG - Intronic
1048906892 8:139097110-139097132 AGCTCCCTGCAGCAGCCTCAGGG - Intergenic
1048914711 8:139171032-139171054 CAGTGTCTGCAGGAGCCAGAAGG - Intergenic
1049592404 8:143468636-143468658 AGCTGCCTGCAGGATCCAGCCGG + Exonic
1049730744 8:144176876-144176898 GTCTGCCTGCAGAAGCCTTAAGG + Intronic
1051745115 9:20288226-20288248 ATCTGCCTGTAGGAACCTCAAGG + Intergenic
1057274444 9:93668835-93668857 AACTGCCTGCAGCGGGCTGAGGG - Intronic
1057337228 9:94165879-94165901 AATTGCCCCCAGGAGCCTGAGGG + Intergenic
1057555208 9:96082651-96082673 AACAGCCTGCAGAAGCCTAGAGG - Intergenic
1059277035 9:113106220-113106242 AGGTGCCTGCAGGAGCCAGGAGG - Intergenic
1059279216 9:113118331-113118353 AGGTGCCTGCAGGAGCCAGGAGG + Intergenic
1060896629 9:127222909-127222931 AACTGCATGCAGGGGTCTGCTGG - Exonic
1062032238 9:134366909-134366931 TTCTCCCAGCAGGAGCCTGAGGG - Intronic
1062217886 9:135399044-135399066 TACTGCCTGAGGGAGCCGGAAGG + Intergenic
1062225826 9:135449697-135449719 ATCTGTCTGCAGGAGTCTGCAGG + Intergenic
1062317264 9:135974080-135974102 TACTGCATGCAGGTGCCTGCTGG - Intergenic
1187468584 X:19548031-19548053 CACTGCCTGCAGGAAGCTTACGG - Intronic
1187546127 X:20254074-20254096 AACAGCCAGCAGGAACTTGAAGG + Intronic
1188994105 X:36861047-36861069 AAATGTTTGCAGGAGCCAGAGGG + Intergenic
1189240823 X:39523043-39523065 CAGTGCCTGCAGGTGACTGAAGG - Intergenic
1190764941 X:53468194-53468216 AACTCCCTGGTGGAGCCTGGGGG - Intergenic
1192240629 X:69324948-69324970 AAATGCCTGCAGGAGCCCTCAGG + Intergenic
1192780173 X:74286103-74286125 GACTGACTGCAGGACCCTGGGGG + Intergenic
1199345580 X:146734772-146734794 AAATGCCTGCAGCAGCTTGTTGG - Intergenic
1200111593 X:153743555-153743577 AGCTGCCCGCCTGAGCCTGACGG + Exonic