ID: 924239448

View in Genome Browser
Species Human (GRCh38)
Location 1:242027032-242027054
Sequence AGTGATGATTAAATAAACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924239448_924239449 -8 Left 924239448 1:242027032-242027054 CCACAGTTTATTTAATCATCACT No data
Right 924239449 1:242027047-242027069 TCATCACTCTATGATCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924239448 Original CRISPR AGTGATGATTAAATAAACTG TGG (reversed) Intergenic
No off target data available for this crispr