ID: 924239449

View in Genome Browser
Species Human (GRCh38)
Location 1:242027047-242027069
Sequence TCATCACTCTATGATCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924239448_924239449 -8 Left 924239448 1:242027032-242027054 CCACAGTTTATTTAATCATCACT No data
Right 924239449 1:242027047-242027069 TCATCACTCTATGATCAGAGTGG No data
924239447_924239449 2 Left 924239447 1:242027022-242027044 CCTAGAGATTCCACAGTTTATTT No data
Right 924239449 1:242027047-242027069 TCATCACTCTATGATCAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924239449 Original CRISPR TCATCACTCTATGATCAGAG TGG Intergenic
No off target data available for this crispr