ID: 924244951 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:242074889-242074911 |
Sequence | CTGTGGTCAAATGAGTATGT TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
924244949_924244951 | 17 | Left | 924244949 | 1:242074849-242074871 | CCAAAAATTGGGGCAGCAAAATT | No data | ||
Right | 924244951 | 1:242074889-242074911 | CTGTGGTCAAATGAGTATGTTGG | No data | ||||
924244948_924244951 | 21 | Left | 924244948 | 1:242074845-242074867 | CCTGCCAAAAATTGGGGCAGCAA | No data | ||
Right | 924244951 | 1:242074889-242074911 | CTGTGGTCAAATGAGTATGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
924244951 | Original CRISPR | CTGTGGTCAAATGAGTATGT TGG | Intergenic | ||
No off target data available for this crispr |