ID: 924244951

View in Genome Browser
Species Human (GRCh38)
Location 1:242074889-242074911
Sequence CTGTGGTCAAATGAGTATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924244949_924244951 17 Left 924244949 1:242074849-242074871 CCAAAAATTGGGGCAGCAAAATT No data
Right 924244951 1:242074889-242074911 CTGTGGTCAAATGAGTATGTTGG No data
924244948_924244951 21 Left 924244948 1:242074845-242074867 CCTGCCAAAAATTGGGGCAGCAA No data
Right 924244951 1:242074889-242074911 CTGTGGTCAAATGAGTATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924244951 Original CRISPR CTGTGGTCAAATGAGTATGT TGG Intergenic
No off target data available for this crispr