ID: 924246852

View in Genome Browser
Species Human (GRCh38)
Location 1:242093635-242093657
Sequence CTTTAGGATCAGAGGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 1, 2: 0, 3: 22, 4: 219}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924246852_924246857 14 Left 924246852 1:242093635-242093657 CCATGTTGCCTCTGATCCTAAAG 0: 1
1: 1
2: 0
3: 22
4: 219
Right 924246857 1:242093672-242093694 AAGAATTGTGTGCTTCACCCTGG 0: 1
1: 0
2: 1
3: 7
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924246852 Original CRISPR CTTTAGGATCAGAGGCAACA TGG (reversed) Intronic
900114748 1:1023711-1023733 CTCTAGGGTCAGAGGGCACATGG + Intronic
901877646 1:12175860-12175882 GTTTAGGATGAGTGGCTACAGGG + Intronic
904161519 1:28525536-28525558 CTTTGGGATTAGAGGGAACTGGG - Intronic
904406104 1:30289159-30289181 CTATGGGTCCAGAGGCAACAGGG - Intergenic
906292584 1:44629106-44629128 CTGGAGGATGAGAGGCCACATGG - Intronic
906834055 1:49063843-49063865 CTGGAGGAACAGAAGCAACAGGG - Intronic
908559662 1:65292954-65292976 CTGTAGGATGGGAGGCCACATGG - Intronic
910948387 1:92617997-92618019 CTTTAGGATGATGGGGAACATGG - Intronic
911519165 1:98908232-98908254 CTTTAGGAGCAAAGGAAAAATGG + Intronic
911885764 1:103297078-103297100 CTTAAGGATCAGAGGAATCAGGG + Intergenic
917462880 1:175247448-175247470 CTTCAGGATGACAGGGAACATGG - Intergenic
918319226 1:183349050-183349072 CTTTGGGATCAGAAGCCACCTGG - Intronic
918586559 1:186194918-186194940 CTTTATCATAAGAGGCATCATGG - Intergenic
918774671 1:188612028-188612050 CTTCAGGATGATAGGGAACATGG - Intergenic
919000565 1:191826587-191826609 CTTCAGGATGAGAGGGAACATGG + Intergenic
924246852 1:242093635-242093657 CTTTAGGATCAGAGGCAACATGG - Intronic
924829658 1:247579631-247579653 CTTCAGGATCATGGGGAACATGG - Intergenic
1066166854 10:32797939-32797961 CTTCAGGATGATAGGGAACATGG + Intronic
1067673120 10:48344337-48344359 CTTTAGGAATAAAGGCAACAGGG - Intronic
1071378556 10:85034648-85034670 CTTCAGGATGACAGGGAACATGG - Intergenic
1071868917 10:89770035-89770057 CTTTGGGTGCAGAGGCAAAATGG - Intronic
1073514688 10:104065863-104065885 CTTCAGGAGAAAAGGCAACAAGG - Intronic
1074238058 10:111606312-111606334 CTGGAAGATCAAAGGCAACATGG - Intergenic
1075198260 10:120379645-120379667 CTTTTGGAGAAGAGGAAACATGG + Intergenic
1075894540 10:125983681-125983703 ATTGAGGAACAGAGGGAACAAGG + Intronic
1079532504 11:21472041-21472063 CTTTAGTATTAGAGTCAATATGG + Intronic
1080878939 11:36301352-36301374 CTTGAGCATCAGAGGCGTCAAGG + Intronic
1082715347 11:56605787-56605809 CTTTAGGATAATGGGAAACATGG - Intergenic
1084389166 11:68863947-68863969 CTTTAGGATCTGAAGGAAGAGGG - Intergenic
1085080243 11:73627936-73627958 CCTTAGGATGAGAGACCACAGGG - Intergenic
1085157222 11:74306853-74306875 CTTTGGGATCAGAGACACCCTGG - Intronic
1085748503 11:79136837-79136859 CTTTAGGATGATAGGGAGCATGG - Intronic
1086904720 11:92405272-92405294 CTAGAGGATCACAGGCATCATGG + Intronic
1088265599 11:107984865-107984887 CTTCAGGATGATAGGCAACATGG - Intergenic
1088376473 11:109146866-109146888 CTTTAGAACCAGAGACTACATGG + Intergenic
1089903790 11:122014872-122014894 CTTCAGGATGATAGGGAACATGG - Intergenic
1090135560 11:124195040-124195062 CTTTTGGATCACAGCCAAAAAGG - Intergenic
1092414094 12:8276671-8276693 CTTTAAGATCAGGGGATACAAGG - Intergenic
1095604068 12:44045883-44045905 CTTTAGGATGATGGGGAACATGG - Intronic
1095927219 12:47591209-47591231 CCTGAGGCTCAGAGGCATCAGGG - Intergenic
1097968912 12:65611227-65611249 CTTGAGGATCAAAGGCACCATGG + Intergenic
1099366096 12:81766645-81766667 CTTTAGGATGATGGGGAACATGG - Intergenic
1099508740 12:83508448-83508470 CTTCAGGATAATAGGGAACATGG - Intergenic
1099736010 12:86566986-86567008 CTTCAGGATGATAGGGAACATGG - Intronic
1101562870 12:105875840-105875862 CATTAAGAACAGAAGCAACAAGG + Intergenic
1102081934 12:110105331-110105353 CTTTAGGATCAGAGACAACAGGG + Intergenic
1108914141 13:55587630-55587652 CTTTAGGATGATGGGGAACATGG + Intergenic
1110142426 13:72147228-72147250 GTAAAGGATCAGAGACAACAAGG - Intergenic
1111057620 13:82971764-82971786 CTTCAGGATCTTAGGGAACATGG + Intergenic
1111198703 13:84906149-84906171 CTTTAGGATGAATGGGAACATGG - Intergenic
1112230948 13:97588906-97588928 CTTCAGGATAATAGGGAACATGG + Intergenic
1112443765 13:99445016-99445038 CATAAGGATCACAGACAACACGG - Intergenic
1114238665 14:20846105-20846127 CTAAAGGAACAGAGTCAACAAGG + Intergenic
1114875231 14:26709060-26709082 CTTTAGGATCTGAATCAACTTGG - Intergenic
1116303045 14:43210819-43210841 AGTTTGGATCAGAGGCAACATGG + Intergenic
1117596101 14:57328619-57328641 CTTCAGGATGATAGGGAACAGGG + Intergenic
1119187616 14:72653981-72654003 CGACAGGATCAGAGGCAACCTGG + Intronic
1120729449 14:87986143-87986165 GTTTAGCATCATAGGAAACATGG + Intronic
1120901377 14:89578689-89578711 GTTTGGAAGCAGAGGCAACAGGG - Intronic
1122082982 14:99279817-99279839 CTTAGGGATCAGAGGGAGCATGG - Intergenic
1122449843 14:101796839-101796861 CTTGAGGAGCAGAGGCAGCAGGG - Intronic
1123837577 15:24211703-24211725 CTTCAGGATTATAGGGAACATGG + Intergenic
1123846800 15:24311457-24311479 CTTCAGGATTATAGGGAACATGG + Intergenic
1123865804 15:24518514-24518536 CTTCAGGATTATAGGGAACATGG + Intergenic
1125585089 15:40814154-40814176 CTTTAAGCTCAAAGGCATCATGG - Exonic
1128425763 15:67541503-67541525 CTTTAAAATCTGAGGTAACAAGG + Intergenic
1128431894 15:67604342-67604364 CTTTAGGAAATGAGGCAACAAGG - Intronic
1129174826 15:73832463-73832485 CTTTGGGAGCAGAGGGAATATGG - Intergenic
1129618243 15:77118162-77118184 CTTTAAGAGCAAAGGCAAAAGGG + Intronic
1130305976 15:82712232-82712254 CTTCAGGAGCAGTGGCAAGATGG - Intergenic
1130672863 15:85928292-85928314 GTTAAGCATCATAGGCAACAGGG + Intergenic
1130756052 15:86764708-86764730 CTTTAGCATCTGAGGCAAAGTGG - Intronic
1131029614 15:89175581-89175603 CCTTGGGATAAGAGGAAACAGGG - Intronic
1131658864 15:94492547-94492569 CTTCAGGATGATAGGGAACATGG - Intergenic
1133355282 16:5131907-5131929 CTTTAAGATCAGGGGATACAAGG - Intergenic
1134376741 16:13682972-13682994 CATTAGGATCACAGGCTGCAGGG - Intergenic
1138923581 16:61563743-61563765 CTGTAGGATTAAAGGCAAAACGG - Intergenic
1140579188 16:76208586-76208608 CTTTAGGATTCCAGGCAAAAAGG + Intergenic
1140982596 16:80125236-80125258 ATTTGGGGTCAGAGACAACAGGG - Intergenic
1143657288 17:8302861-8302883 CTTAAAGATTAGAAGCAACATGG + Intergenic
1144036485 17:11370612-11370634 CTTGAGGAGCACAGGCAAGATGG - Intronic
1146526426 17:33570815-33570837 CTTGAGGATGAGATGCCACATGG - Intronic
1146912869 17:36659467-36659489 CTTTAGGGTCAGTGGAACCAGGG - Intergenic
1147403108 17:40192670-40192692 TTTGAGGATCAGAGGCACGAAGG - Exonic
1149408553 17:56380291-56380313 CTTTAGAAACAGAGCCAAGATGG + Intronic
1150204420 17:63391368-63391390 CTTTAGGATCAGACACAACTGGG + Intronic
1152026683 17:77814201-77814223 CTGGAGGATGAGAAGCAACATGG + Intergenic
1154506329 18:15044135-15044157 CTTCAGGATAATGGGCAACATGG - Intergenic
1155134341 18:22973159-22973181 TTCTAGTATCAGAGGCAACATGG - Intronic
1156601734 18:38615222-38615244 TTCCAGGATCAGAGGCTACATGG + Intergenic
1156606542 18:38673012-38673034 CTTTAGGATGATGGGGAACATGG - Intergenic
1156859776 18:41822315-41822337 CTTTTGGATCAGGGACAATATGG - Intergenic
1156883823 18:42111493-42111515 CCTCAAGTTCAGAGGCAACATGG + Intergenic
1157312498 18:46562609-46562631 CTGTAGACTCAGAGGCCACAGGG + Intronic
1158652748 18:59302142-59302164 CATTAGGAAGAGAGGAAACAAGG - Intronic
1159353343 18:67302112-67302134 CTTTAGGAACAGAGAACACATGG + Intergenic
1159556804 18:69954509-69954531 CTTTAGGATTTGAGGCAGCACGG - Intronic
1163528579 19:17836169-17836191 CTGTATGAACAGAGGCAGCAGGG - Intronic
1166178778 19:41092633-41092655 CTTTAGGCTCAGAGAGACCAGGG - Intronic
1168046976 19:53801130-53801152 GTTTAGGAGCAGAGACAACCTGG + Intronic
926697791 2:15782764-15782786 CTATATCATCAGAGGCAACGGGG + Intergenic
928316250 2:30248978-30249000 CTATAGGATTAGAGGCACCAGGG + Intronic
929865739 2:45715902-45715924 CTTTGAGATGAGAGGCATCATGG - Intronic
929920348 2:46167179-46167201 CTTTGGAATCAGATGCAACCAGG + Intronic
931940261 2:67244340-67244362 CTTTAGAGGCAGAGTCAACAGGG - Intergenic
936641385 2:114315952-114315974 CTTCAGGATGATAGGGAACATGG - Intergenic
937211330 2:120273690-120273712 CTGTAAGACCAGAGGCAAGATGG + Intronic
937765803 2:125659255-125659277 CTTCAGGATGATAGGGAACATGG - Intergenic
939198310 2:139001511-139001533 CTTTAGGAGCAGAAATAACAAGG + Intergenic
940021629 2:149162037-149162059 CTTGAGGATCAGAGGAATGACGG + Intronic
941134173 2:161693029-161693051 CTTTAGAATAAAAGGGAACATGG - Intronic
941901738 2:170685690-170685712 CTTTTGGGTCAGAGACAAAATGG + Intergenic
942692159 2:178597265-178597287 CTTTAGGTTCACTGGAAACATGG + Intronic
944940545 2:204620481-204620503 CTTTAACATCAGAGGGGACAGGG + Intronic
945001298 2:205353933-205353955 CTTTAGTATATGAGGAAACAGGG + Intronic
1170086232 20:12535432-12535454 CTTTAGGATTGCAGGCCACATGG + Intergenic
1170655187 20:18280030-18280052 CTTTATTATCAGTGGCAACAGGG - Intergenic
1171500249 20:25587444-25587466 TGTGAGGATCAGAGGCAAAATGG + Intergenic
1173919298 20:46731779-46731801 CTTTAGGAACACAGGGACCAGGG + Intronic
1175782971 20:61695478-61695500 CTCAAGGATGAGAGGCACCATGG - Intronic
1176759354 21:10763024-10763046 CTTTTGGACCAGAGGCCCCAAGG + Intergenic
1176791524 21:13324888-13324910 CTTCAGGATAATGGGCAACATGG + Intergenic
1176925374 21:14743205-14743227 CTTCAGATTCAGAGGGAACAAGG + Intergenic
1177505393 21:22012959-22012981 CTTGAGGATGATAGGGAACATGG + Intergenic
1177551841 21:22633045-22633067 TTTTAGGTTCAGAGGCTAGAAGG - Intergenic
1179910161 21:44443212-44443234 CTTGAAGCTCAGAGGCAGCAGGG + Intergenic
1181972703 22:26704526-26704548 CTATAGGAGCAGACACAACAGGG + Intergenic
1183512177 22:38242747-38242769 TTTTAGCATCAGAGGCAGCGGGG - Intronic
1183563933 22:38599302-38599324 CTTTAGGATAAATGGCAACAGGG + Intronic
1184857580 22:47154815-47154837 CTTTAGGAGCAGAAGCAGCCTGG + Intronic
951805052 3:26634718-26634740 CTTTATGATCAAAGCCAACCTGG - Intronic
952157391 3:30657945-30657967 CCTTAAGATCAGAGGCAAACAGG - Intronic
954511314 3:51128425-51128447 CTTTAGGATGATGGGGAACATGG + Intronic
956404751 3:68916747-68916769 CTTGAGGATAAGAGGCAGAAGGG - Intronic
956759510 3:72427168-72427190 GTTTAGAATCAGAGGAAACAAGG - Intronic
957059126 3:75467542-75467564 CTTTAAGATCAGGGGATACAAGG - Intergenic
957333613 3:78797908-78797930 CTTTATGATATGAGGAAACAGGG + Intronic
957602938 3:82361291-82361313 CTTTGGGATTTGAGGCAACATGG + Intergenic
957754760 3:84470689-84470711 CTTCAGGATGATAGGCAACATGG - Intergenic
961294327 3:125872183-125872205 CTTTAAGATCAGGGGATACAAGG + Intergenic
962445309 3:135458458-135458480 CCTGAGGAGCAGAGGAAACATGG - Intergenic
964357233 3:155862002-155862024 CTTGATGGTCAGAGGCAAGATGG - Intergenic
964852256 3:161107147-161107169 CTGCAGGATAAGAGGCCACATGG - Intronic
966264568 3:178023571-178023593 CTTGAGGATCAGTGGTAACAGGG + Intergenic
967268270 3:187711154-187711176 CTTTAGGATCTAAGGGAATATGG + Intronic
967276775 3:187783735-187783757 CTTTAAGATCATAGTCAACATGG - Intergenic
969003034 4:3997737-3997759 CTTTAAGATCAGGGGATACAAGG - Intergenic
969120830 4:4909749-4909771 CTTTAGGGTCAGAGGGCTCAAGG + Intergenic
969810899 4:9647080-9647102 CTTTAAGATCAGGGGATACAAGG + Intergenic
971328152 4:25661241-25661263 CTTTATGCTCAGAGGCATAAAGG + Intronic
972229822 4:37058601-37058623 TTTTATGATCAGAGTCATCAGGG + Intergenic
972343045 4:38169178-38169200 CTTTGGGGTCAGATGCACCAGGG + Intergenic
975000525 4:69219996-69220018 TTTTAGGCTCATAGGCAAAAAGG - Intergenic
975005244 4:69275198-69275220 TTTTAGGCTCATAGGCAAAAAGG + Intergenic
975013657 4:69384186-69384208 TTTTAGGCTCATAGGCAAAAAGG + Intronic
975014920 4:69403537-69403559 TTTTAGGCTCATAGGCAAAAAGG + Intronic
980267629 4:130539091-130539113 CTGTAGTTTCAGAGGCAGCAAGG + Intergenic
981749202 4:148077113-148077135 CTGGAGGATGAGAGGCCACATGG + Intergenic
981944471 4:150325162-150325184 CTTAAGGATGAAAGGCCACATGG + Intronic
983410597 4:167392575-167392597 TTTTAGGACCAGAAGTAACATGG + Intergenic
984934785 4:184880670-184880692 CCTTATGAAAAGAGGCAACATGG - Intergenic
985182122 4:187276129-187276151 CTTAAGGAACAGAGGTATCATGG + Intergenic
987879396 5:23722631-23722653 CCTTCAGGTCAGAGGCAACATGG + Intergenic
988107926 5:26773804-26773826 CTTCAGGATGATAGGGAACATGG - Intergenic
988233131 5:28505828-28505850 CTTTAGGATGATGGGAAACATGG + Intergenic
988357158 5:30192796-30192818 TTTTAGTATCAGAAGTAACAAGG - Intergenic
988562301 5:32292097-32292119 CTTCAGGATGATAGGGAACATGG - Intronic
992344963 5:75867288-75867310 CTTCAGTAGCAGATGCAACAGGG + Intergenic
995651743 5:114377301-114377323 CCTTAGGATCAGAGGCAGAGTGG - Intronic
997827957 5:137124420-137124442 CTTCAGAATAGGAGGCAACAGGG - Intronic
1002155265 5:177272971-177272993 TCTTAGGATAAGAGGCAAGAAGG + Intronic
1002772374 6:300984-301006 CTTTGGCAACAGAGGCAGCAGGG - Intronic
1004835314 6:19524474-19524496 CTTTATGAGAACAGGCAACAGGG - Intergenic
1005995734 6:30930311-30930333 CTTTAGCATGGGAGGCAGCACGG - Intergenic
1006483160 6:34314952-34314974 CTTTAAAATCAGAGGCACCTAGG - Intronic
1007491677 6:42228003-42228025 CTTTGGGATAAAAGGCAACCGGG + Exonic
1007838442 6:44696318-44696340 CTGTAGGACAACAGGCAACATGG + Intergenic
1008079214 6:47177307-47177329 CTTCAGGATAATAGGGAACATGG + Intergenic
1009660537 6:66605722-66605744 CTTCAGGATCATGGGGAACATGG + Intergenic
1010568651 6:77450681-77450703 CTTTAGCATCACAGCCCACATGG + Intergenic
1011069277 6:83362916-83362938 CTTCAGGATGATAGGAAACATGG - Intronic
1011338617 6:86287305-86287327 CTTAAAGATTAGAGGCAAGATGG - Intergenic
1011771524 6:90678697-90678719 ATTCAGGATCACAGCCAACAGGG - Intergenic
1012002105 6:93666187-93666209 CTTCAGGATAATAGGGAACATGG - Intergenic
1012004740 6:93698871-93698893 CTTTAGGGTCAGAGAGAACTTGG - Intergenic
1013493811 6:110677623-110677645 CTCTAGTATCACTGGCAACATGG + Intronic
1013715412 6:112955283-112955305 CTTTACCATCAGAGTGAACAGGG + Intergenic
1014624293 6:123707070-123707092 CTCTAGGGACAGAGGCAAAAAGG + Intergenic
1014896306 6:126904177-126904199 CTATAGTATCAAATGCAACAAGG - Intergenic
1016028640 6:139314787-139314809 CTTGAGGATTAGAAGCAAGATGG - Intergenic
1019001195 6:168753904-168753926 CATAAGGATTAGAGGGAACAGGG + Intergenic
1020321981 7:6945856-6945878 CTTTAAGATCAGGGGATACAAGG - Intergenic
1020460673 7:8426276-8426298 CTTCAGGACCAGATGAAACAGGG - Intergenic
1022214050 7:28240610-28240632 CTACAGGAGCAGAGGCAACCGGG + Intergenic
1022823428 7:33984139-33984161 TTTTGGGAGCAGAGGCAATAAGG - Intronic
1023637199 7:42224478-42224500 CTTAAGAACCAGAGGCCACATGG + Intronic
1024866270 7:53907605-53907627 CTTCAGGATGAGGGGGAACATGG - Intergenic
1027800924 7:82747850-82747872 CTGGAGGATCAGAGACAAGAAGG + Intergenic
1032850309 7:135789281-135789303 ATTTAGGAGCAGAGGCATCAAGG + Intergenic
1034170036 7:149055840-149055862 CTTCAGGATGATGGGCAACATGG - Intergenic
1038573080 8:28679757-28679779 ATTTAGGATCATAGTAAACAAGG - Intronic
1038611498 8:29063602-29063624 CTTTTGGCTCATATGCAACAAGG - Intronic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1041179831 8:55236057-55236079 CTTTAGGATCAGTGCAAACCAGG - Intronic
1042000889 8:64122734-64122756 CTTCAGGATAACAGGGAACATGG + Intergenic
1042877983 8:73457355-73457377 CATTAGGATAAGGGCCAACAAGG + Intronic
1043237384 8:77885047-77885069 CTCCTTGATCAGAGGCAACAAGG + Intergenic
1044466063 8:92507200-92507222 CCTTGGCATCAGTGGCAACATGG - Intergenic
1045562765 8:103281796-103281818 CTGGAGGATTAGAGGCTACATGG + Intergenic
1046436447 8:114195623-114195645 CTTCAGGATAATAGGGAACATGG + Intergenic
1047846875 8:128815725-128815747 TGTTAGCATCAGAGGGAACATGG + Intergenic
1048436327 8:134421908-134421930 CATGAGCAGCAGAGGCAACATGG + Intergenic
1048679424 8:136823420-136823442 CTTTATGAGAAGAGGCAACGAGG + Intergenic
1048819441 8:138366938-138366960 CTGGAGGATGAGAGGCCACAAGG + Intronic
1049276900 8:141724508-141724530 CTAAAGTATCAGAGGCAACTAGG + Intergenic
1049582074 8:143417341-143417363 CTTTAGGATCTGGGCCAAAATGG - Intergenic
1050002177 9:1089342-1089364 CTTTAGAGTGAGAGGCAATATGG - Intergenic
1050888599 9:10795492-10795514 CTTCAGGATGATGGGCAACATGG + Intergenic
1051350913 9:16197256-16197278 CTTTTGGCTGAGAGGCAACATGG + Intergenic
1051379402 9:16440033-16440055 CTTTTGGAACAGGGGTAACATGG + Intronic
1051725922 9:20088366-20088388 CTAGAGAATCAGAGGCAACTAGG + Intergenic
1052337845 9:27337941-27337963 CTCTAGGACCACAGGCAGCATGG - Intronic
1052929811 9:34047158-34047180 ATTGAGGGTGAGAGGCAACAGGG + Intronic
1057408364 9:94794011-94794033 CTTTAGGAGCACAGGACACAAGG + Intronic
1059639580 9:116203685-116203707 CATAAGGATTAGAGGCAACACGG - Intronic
1203404644 Un_KI270507v1:2491-2513 CTTTTGGACCAGAGGCCTCAAGG - Intergenic
1203397127 Un_KI270519v1:32584-32606 CTTTTGGACCAGAGGCCTCAAGG + Intergenic
1187722804 X:22169639-22169661 CTGGAGGAACAGAGGCATCAGGG + Intronic
1188107408 X:26161017-26161039 CCTGAGGAACAGAGGCATCACGG - Intergenic
1188548069 X:31332176-31332198 CTAAAGGATCAGAAGCAACCTGG - Intronic
1189328362 X:40127270-40127292 CTTGAGGATGTGAGGCCACAGGG + Intronic
1191095553 X:56669929-56669951 CTTGAGGATGATAGGAAACATGG + Intergenic
1191133881 X:57043259-57043281 CTTCAGGATGATAGGGAACATGG + Intergenic
1191946519 X:66540280-66540302 CTTCAGGATGATAGGAAACATGG - Intergenic
1192442325 X:71183703-71183725 CTTGACAATCAGAGACAACAAGG + Intergenic
1192673088 X:73167149-73167171 CTTCAGGATGATAGGAAACATGG + Intergenic
1194233021 X:91347544-91347566 CTTCAGGATGATAGGGAACAAGG - Intergenic
1195097196 X:101514467-101514489 CTTCAGGATAATAGGGAACATGG + Intronic
1197044585 X:121979568-121979590 CTTTAGGATGATGGGGAACATGG - Intergenic
1197405336 X:126041458-126041480 CTTCAGGATGATGGGCAACATGG - Intergenic
1197537438 X:127707741-127707763 CTTTAGGATGATGGGGAACATGG - Intergenic
1199116406 X:143998008-143998030 CTTCAGGATGATAGGGAACATGG + Intergenic
1199535464 X:148897754-148897776 CCTTAGCATCAGGGGCAAGAGGG + Intronic