ID: 924246927

View in Genome Browser
Species Human (GRCh38)
Location 1:242094257-242094279
Sequence GGCACTCAAAAGTCCCCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924246927 Original CRISPR GGCACTCAAAAGTCCCCTGA AGG (reversed) Intronic
902968912 1:20032538-20032560 TGCACTCAAACTTCCCCTCAGGG - Intronic
903853057 1:26319819-26319841 GCTATTCAAAAGTCCCCTGAGGG + Intronic
906660170 1:47576316-47576338 GGCACTATAATGTCCCCTTAGGG + Intergenic
910403933 1:86865867-86865889 GCAACTCAAATGTCCACTGATGG + Intronic
910901842 1:92129680-92129702 GGCACTCAAAATGGCCCTAAAGG - Exonic
911038528 1:93574234-93574256 GGCACTCAGATGTCACATGAAGG + Intronic
911683467 1:100746113-100746135 GGCACTATAAAGTCCCCTTAAGG + Intergenic
914897403 1:151689026-151689048 GCCATTAAGAAGTCCCCTGAAGG + Intronic
918168168 1:181970425-181970447 GGCTCTCAGATGGCCCCTGAGGG - Intergenic
924246927 1:242094257-242094279 GGCACTCAAAAGTCCCCTGAAGG - Intronic
924902227 1:248413064-248413086 AGCAATCAAAAGCCCACTGATGG + Intergenic
1067977645 10:51043876-51043898 GGTATTCAAAGGTCCCGTGATGG + Intronic
1068464718 10:57375143-57375165 GCCACTCTGAAGTCTCCTGAAGG - Intergenic
1068670158 10:59714229-59714251 GGTTCTCAAAAGTTCACTGAAGG + Intronic
1072691671 10:97576136-97576158 GGCTCTCAAAACCACCCTGAAGG + Intronic
1075131204 10:119741449-119741471 GACACTCAGATGTCCACTGAAGG - Intronic
1076452465 10:130566199-130566221 GGCACTATAAATTCCTCTGAAGG - Intergenic
1080265478 11:30396249-30396271 GGCATTCAAAAGGCTTCTGAGGG - Intronic
1084657970 11:70530148-70530170 GCAACCCAAATGTCCCCTGATGG + Intronic
1085433662 11:76480259-76480281 GGCACTCATAAGTGCTGTGATGG + Intronic
1089550071 11:119267737-119267759 GGCACTCAAATGTTTTCTGAAGG + Intronic
1090476951 11:127031744-127031766 GGCACTTTACAGTCACCTGAGGG + Intergenic
1095047659 12:37526583-37526605 GGCTCTGAAATGTCCCCTCATGG + Intergenic
1095079736 12:37985101-37985123 GGCTCCCAAATGTCCCCTCATGG - Intergenic
1095193338 12:39284304-39284326 GGCCCTCAAAAGCCCTCTAATGG - Intergenic
1095817734 12:46442962-46442984 GGCACTTAAAATTTCCCTAAGGG - Intergenic
1097650613 12:62292968-62292990 GGCAAGATAAAGTCCCCTGATGG + Intronic
1103599951 12:122048340-122048362 TGAACTCAAAAGCCCCATGAGGG - Intronic
1113219956 13:108088533-108088555 GACACTTGAAAGTCCCTTGAGGG + Intergenic
1117000878 14:51370014-51370036 GGCGCTGAAATGCCCCCTGATGG - Intergenic
1120995398 14:90414375-90414397 AGCACCCAAATGTCCACTGACGG + Intergenic
1202860687 14_GL000225v1_random:79433-79455 GGCCCACGAAAGCCCCCTGAGGG + Intergenic
1126774813 15:52091645-52091667 GGCTCTAAAAATTCCCCTGGTGG - Intergenic
1127147387 15:56038548-56038570 GGCACTCAGAAGCCATCTGAAGG - Intergenic
1127468965 15:59273420-59273442 GGCAGTTCAAAGTCCCTTGAAGG + Intronic
1127685776 15:61342177-61342199 GGCACTCAAAACTGCCCAGCAGG + Intergenic
1128340656 15:66820562-66820584 GGCATGCAAAAGTCCCCTCCTGG - Intergenic
1132914789 16:2338098-2338120 GGCAATGGAAAGTCCCCAGAGGG + Intronic
1137759786 16:50931050-50931072 GGCACCCAAGATTCCCCTGGAGG - Intergenic
1140436919 16:74954712-74954734 GCCAGTCAAATGTCCTCTGATGG + Intronic
1140722756 16:77786210-77786232 GTCTCTCAAATGTCCCCTGCGGG + Intergenic
1141216826 16:82033036-82033058 GCCACACAGAAGTCCCATGAAGG - Intergenic
1142427066 16:90006964-90006986 GGGACTCACAAGGCCCATGATGG - Intronic
1144106791 17:11993429-11993451 GGCACTCAAAAGACCTCTCTTGG - Intronic
1147140952 17:38460466-38460488 GGGACTCAAAAGACATCTGAGGG - Intronic
1157746097 18:50137206-50137228 GGCACTCCAGGTTCCCCTGAAGG + Intronic
1160556900 18:79731232-79731254 CTCACTCAAAGGCCCCCTGACGG - Intronic
1160782779 19:885193-885215 GGAACGCAAATGTCCCCGGATGG + Intronic
1161768963 19:6221193-6221215 GACCCACAAAAGGCCCCTGAGGG + Intronic
1162545327 19:11325607-11325629 GACACTCGTAAGACCCCTGAGGG + Intronic
926533083 2:14076629-14076651 GGTACTAAAATATCCCCTGAAGG - Intergenic
936744135 2:115553799-115553821 GGCACTCAAAATTATGCTGAGGG + Intronic
938948493 2:136236056-136236078 GGCACTCAAATGTCCCCCAAAGG - Intergenic
947577590 2:231288649-231288671 ATCCCTCAAAGGTCCCCTGAAGG + Intronic
1169777305 20:9269789-9269811 TGAACTCAAAAGTCCAGTGATGG - Intronic
1170194313 20:13674752-13674774 AGCACTCAACAGACTCCTGAAGG - Intergenic
1173246351 20:41340470-41340492 GGCGCTCAAACGTCCCCTCCTGG - Intergenic
1173428963 20:42968571-42968593 GCAAATCAAAAGTCCACTGAAGG + Intronic
1176899177 21:14418902-14418924 GAAACTCAAAAGTCCCCAAATGG + Intergenic
1180414305 22:12694068-12694090 GGCTCACGAAAGCCCCCTGAGGG + Intergenic
1181361901 22:22343976-22343998 GCCACTCACCTGTCCCCTGATGG + Intergenic
1184110355 22:42390486-42390508 TGCACTGAAAGGTCCCATGAGGG + Intronic
1184684658 22:46090670-46090692 GGGTCTCAAGAGTCCCCTGAAGG - Intronic
955554577 3:60122362-60122384 TGAACTCAAATGTTCCCTGAGGG - Intronic
955711978 3:61789583-61789605 AGTACTGAAAAGTCCCATGAGGG - Intronic
957202181 3:77150154-77150176 AACACTCAAAACTCCCCTGCTGG + Intronic
963007100 3:140736712-140736734 GGCACACAAAAGTCCTCTTTGGG + Intergenic
965351038 3:167610978-167611000 GGCAATGAATAGTCACCTGAAGG + Intronic
965899655 3:173623008-173623030 GGGACTCAACACTCCCTTGAGGG - Intronic
969158833 4:5237312-5237334 TGCACCCAACAGTCCCCTGCAGG - Intronic
969565822 4:7977438-7977460 GGCACACAAACGTCCCCTGTGGG + Intronic
970942337 4:21649585-21649607 GGCCTTAAAAAGTCCCCTGTAGG + Intronic
972619467 4:40733011-40733033 GGGACTCACAAATCCCCTCAGGG + Intergenic
978869360 4:113556690-113556712 GGCTCCCCAAAGACCCCTGAAGG + Intronic
979381456 4:120011540-120011562 GGCACTCACCACTCCCCTGCTGG + Intergenic
990242407 5:53828594-53828616 AGCACACAAAAGTTCCCAGATGG - Intergenic
994825996 5:104713273-104713295 GGCAGTCAGCAGTCTCCTGAAGG + Intergenic
996487627 5:124055677-124055699 GGCTCTCAACAGTCCCCAGTGGG - Intergenic
1002095489 5:176828470-176828492 GGGACCCAAGAGTCCCTTGAGGG + Intronic
1002853130 6:1014173-1014195 GGCAATGAAATGTCACCTGAAGG + Intergenic
1004811924 6:19271766-19271788 GGCAATTAAAAGTCCCTTCATGG - Intergenic
1005830326 6:29665846-29665868 GTCAATAAAAAGTCCCTTGAGGG + Intronic
1011124196 6:83988596-83988618 GACACTCAAAAGTCTATTGAAGG - Intergenic
1015370654 6:132448532-132448554 GGCACTGAAAAGTCTACTGTTGG + Exonic
1018905852 6:168075508-168075530 GGCACTCACAGGTGCTCTGATGG - Intronic
1021798609 7:24283445-24283467 GCGACTCAAAATTCCCCAGAGGG - Intergenic
1023938298 7:44755046-44755068 GGCACTCAGAAGCAGCCTGAAGG + Intronic
1023983215 7:45081479-45081501 TGGACCCAAAGGTCCCCTGATGG + Intronic
1025107343 7:56182852-56182874 GGCACTCACAAGCCCCGTAAGGG + Intergenic
1028623297 7:92847846-92847868 CTCACTCAAAAGTCACCAGAGGG + Intergenic
1030327805 7:108239707-108239729 GGCAGACAAAAGGCACCTGAGGG + Intronic
1034254724 7:149718489-149718511 GCCACTTTAAAGTCCACTGAAGG + Intronic
1038478570 8:27886080-27886102 GGAACTGAAAAGTGCCCTCAAGG + Intronic
1044887077 8:96790784-96790806 GTCTCTCAAAACTCCCCTAAGGG - Intronic
1048856459 8:138690496-138690518 AGAAGTCAAAGGTCCCCTGACGG - Intronic
1049184992 8:141245596-141245618 AGCACACCAAAGTCACCTGATGG + Intronic
1049812733 8:144582737-144582759 TGCACTCAGAAGTCCAATGAAGG + Intronic
1053267978 9:36729757-36729779 GGCACTCATAAGTCCCAGAATGG + Intergenic
1055518513 9:77057517-77057539 GGAACTCAAAAGACCCATGCTGG - Intergenic
1056539735 9:87561040-87561062 GGCACTCAAATGTCCACTGATGG - Intronic
1061078792 9:128357655-128357677 GGCTCTCAAGAGTTCCCTGGTGG + Intronic
1061993682 9:134173562-134173584 GGCACTGAAATGTCACCTGGAGG - Intergenic
1187311816 X:18151898-18151920 GGCTTTCAAAAGTCAGCTGAAGG + Intergenic
1191579897 X:62749029-62749051 GGCTCCCAAATGTCCCCTCACGG + Intergenic
1195668081 X:107448702-107448724 GGCCCTCAAAACTCCTCTGAAGG + Intergenic
1200062427 X:153489545-153489567 GGCACTCATCAGTCCTCAGATGG + Intronic
1202337764 Y:23828792-23828814 GGCACTCACCAGTGCCCAGAAGG + Intergenic
1202533002 Y:25841279-25841301 GGCACTCACCAGTGCCCAGAAGG - Intergenic