ID: 924248351

View in Genome Browser
Species Human (GRCh38)
Location 1:242106866-242106888
Sequence ATGGAGAAGAAGAGTGTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924248346_924248351 10 Left 924248346 1:242106833-242106855 CCTAAAGGATCAGTGGTTATGAG 0: 1
1: 0
2: 0
3: 12
4: 136
Right 924248351 1:242106866-242106888 ATGGAGAAGAAGAGTGTTGTAGG 0: 1
1: 0
2: 2
3: 37
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924248351 Original CRISPR ATGGAGAAGAAGAGTGTTGT AGG Intronic
900957522 1:5896027-5896049 AGGGAGCAGAAGAGTGTATTTGG + Intronic
901093699 1:6661516-6661538 CTGGAGAAGAAGAGTGGTCTTGG - Intronic
903022935 1:20406528-20406550 ATTGAGAAGATGAGTCTTCTTGG + Intergenic
907588822 1:55646248-55646270 ATGGAGAAGAGGGGTGGTGTTGG - Intergenic
908418012 1:63932299-63932321 ATGGAGAGGAAGTGGGTTGATGG + Intronic
908432383 1:64071816-64071838 ATGGAGAAGCAGGGTTCTGTGGG + Intronic
908664060 1:66469856-66469878 ATGGTCAAGAAGAGTATTTTAGG + Intergenic
909665086 1:78123327-78123349 ATGGGGAAGAAGAGTGTTCTAGG + Intronic
911411351 1:97511442-97511464 ATGGAGAAGCAGTGTAGTGTGGG - Intronic
911525368 1:98978349-98978371 ATGGAGAAGAAGATTGAAGATGG - Intronic
911593326 1:99772436-99772458 ATGGGGAAGAAGAGGGCTTTTGG - Intergenic
912068580 1:105779063-105779085 ATGGAGATGAGGACTGTTTTGGG + Intergenic
913556222 1:119969808-119969830 ATGAAGATGAAGAGTGTGGGGGG - Intronic
913649505 1:120898602-120898624 AGGGAGAAGAATAGAGTTTTAGG - Intergenic
914639663 1:149592680-149592702 AGGGAGAAGAATAGAGTTTTAGG - Intergenic
914679038 1:149926217-149926239 GTGGTGAAGAAGAAAGTTGTTGG - Intronic
916843179 1:168621375-168621397 AAGGAAAAGAAGAGAGATGTTGG - Intergenic
917958384 1:180123700-180123722 ATGGAAAAGATGAGTGTTCAAGG - Intergenic
919913373 1:202125715-202125737 ATAAAGAAGAAGGGTGTTGTGGG - Intronic
920081470 1:203376928-203376950 AAGGAGAAGAAGAGAGATGGGGG + Intergenic
920693470 1:208164265-208164287 ATGGAGCAGAAGAGGGTTTTGGG - Intronic
920759997 1:208774327-208774349 AAGGAGAAGAAGAAATTTGTTGG + Intergenic
921780788 1:219160856-219160878 ATTTAGAAGAAGAGTGAAGTAGG - Intergenic
922111908 1:222567065-222567087 ATGGATAAGCAAAATGTTGTAGG + Intronic
922652995 1:227357127-227357149 TTAGATAATAAGAGTGTTGTTGG - Intergenic
923454342 1:234150313-234150335 ATTGTGAGGAAGAGTGTTGTTGG + Intronic
923487879 1:234453273-234453295 AGGGACAGGAAGAGTGGTGTGGG + Intronic
923590919 1:235318945-235318967 ATGGATAAGAAGTTTCTTGTTGG + Intronic
923763625 1:236871325-236871347 ACGGAGAAGGATAGAGTTGTGGG - Intronic
924248351 1:242106866-242106888 ATGGAGAAGAAGAGTGTTGTAGG + Intronic
924490951 1:244536797-244536819 ATGGAGAAGAAGATTGGTGGAGG + Intronic
924646223 1:245879421-245879443 ATGGAGACGAAGAGTGTAAGAGG + Intronic
1063537870 10:6902885-6902907 ATGTAAAAGAACAGTGTTTTTGG + Intergenic
1063953532 10:11245882-11245904 ATGGAGAAGCAGTGTGGTTTAGG + Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1065193258 10:23235148-23235170 ATGGAAAAGAATAGCGTAGTTGG + Intronic
1065954835 10:30684314-30684336 ATTGGGGAGAAGAGTGTAGTTGG - Intergenic
1066485626 10:35840773-35840795 ATGGAGAAGAACAAAGTTGGAGG - Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067218682 10:44325417-44325439 CTGGAGAAGAGGAGTGAGGTAGG - Intergenic
1068930663 10:62585780-62585802 ATAGAGAAGAAGAGTTTTGGGGG - Intronic
1071696993 10:87887134-87887156 ATTCAGAAGAAGAGAGCTGTAGG + Intronic
1073055450 10:100697782-100697804 AGGGAGAAGAAGAGAGTTTTAGG + Intergenic
1075193339 10:120331567-120331589 AGGGAGAAGAAGAGAGGTGGAGG - Intergenic
1076002972 10:126927020-126927042 ATTGAGAAGGAGAGACTTGTAGG + Intronic
1076123732 10:127957638-127957660 AAGGAGAAGAACAGAGTTGGAGG - Intronic
1076375147 10:129978782-129978804 ATGGTTCAGAAGAGTGTGGTTGG - Intergenic
1076711750 10:132339501-132339523 CTGGAGGAGAAGAGTGTTCCGGG + Intronic
1077972730 11:7212236-7212258 TGGGAGAAAAAGAGTGCTGTAGG + Intergenic
1078414579 11:11155013-11155035 AAGGAGAAGCAGAGAGTGGTGGG + Intergenic
1078825895 11:14930140-14930162 ATAAAGAGAAAGAGTGTTGTAGG + Intronic
1082143564 11:48638625-48638647 AGGGAGAAGAAAAGAGATGTTGG - Intergenic
1082772590 11:57219855-57219877 ATGGAGAAGAGGAGGGGTGGGGG + Intergenic
1083779805 11:64911967-64911989 ATGGAGAAGAAGAGGTCTGTGGG + Exonic
1083807425 11:65083459-65083481 AAGGCTAAGGAGAGTGTTGTGGG - Intronic
1085349233 11:75787941-75787963 ATGGAGAAGAAGAGGCCTGATGG - Intronic
1085944697 11:81254197-81254219 ATGGAGAAAATGTGTGTGGTAGG + Intergenic
1086207306 11:84274925-84274947 ATGGAGAAGAAGCATGTGGCTGG - Intronic
1086882600 11:92166988-92167010 ATTGAGAAGATAAGTGTTATAGG - Intergenic
1087985092 11:104668946-104668968 TTAGAGAGGAAGAGTGTTCTGGG + Intergenic
1088184583 11:107151237-107151259 ATGGAGAAGAAGAGTTCTCTTGG - Intergenic
1088616129 11:111630655-111630677 ATGGAGTAGAAGAGTGGCTTGGG + Intronic
1090461207 11:126893073-126893095 CAGGAGAAGAACAGTGTTCTTGG + Intronic
1090841584 11:130493680-130493702 TTTGATAAGAAGTGTGTTGTAGG + Intergenic
1091046685 11:132331799-132331821 ATGAAGAATAAGAGTGATATGGG + Intronic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092488713 12:8925557-8925579 ATGTGGAAGGAGAGTGTTGGAGG + Intronic
1092783026 12:12004782-12004804 AGGGAGAAGAAGCGTGTTTTGGG - Intergenic
1093603246 12:21056935-21056957 ATGGAGATGGAGTGTGTTTTTGG + Intronic
1095306716 12:40647140-40647162 ATGGATAAGAAGCCTGTTGGAGG - Intergenic
1097476594 12:60064662-60064684 ATGGAGAAGAAAAATGGTATCGG - Intergenic
1099339931 12:81417434-81417456 ATGGCAAAGAAGAGAGTTTTAGG + Intronic
1099709100 12:86197041-86197063 ATGTAGAAGCACAGTGTTGAAGG - Intronic
1100642665 12:96497337-96497359 AAGGAGAAGAAGAAAGTTGGAGG + Intronic
1101781031 12:107836179-107836201 ATGAAAAAGAATAGTGTTGGAGG + Intergenic
1103041039 12:117695805-117695827 ATGGGGAAAAAGAGTCCTGTGGG + Intronic
1103251272 12:119502008-119502030 GGGGAAAAGAAGAGTATTGTGGG - Intronic
1103257420 12:119553984-119554006 GGGGGGAAGAGGAGTGTTGTAGG + Intergenic
1104109889 12:125695102-125695124 AATGGGAGGAAGAGTGTTGTAGG - Intergenic
1104380265 12:128301127-128301149 ATGGAGGAGAGGTGTGCTGTGGG + Intronic
1106772978 13:32980656-32980678 ATGGAGAAGAAAACAGTTCTGGG + Intergenic
1107440969 13:40426875-40426897 ATGGGGAAGAGGAGTGGTCTTGG - Intergenic
1107461205 13:40605523-40605545 ATTGAGAAGTACAGTGTGGTTGG - Intronic
1108117070 13:47140427-47140449 ATCTTGAAGCAGAGTGTTGTGGG + Intergenic
1108530191 13:51321137-51321159 ATGGTAAAGAAGTGTGTTATGGG - Intergenic
1108583080 13:51844055-51844077 TTGGAGCAGATAAGTGTTGTTGG - Intergenic
1108777150 13:53780595-53780617 ATGCAGAAGAAGGGGGTTGGTGG - Intergenic
1109034617 13:57240388-57240410 ATGGAGAAGACAAGAGTTGATGG + Intergenic
1110596204 13:77323437-77323459 ATGTAGAGGAAGAATGTTCTGGG - Intronic
1110783864 13:79499920-79499942 AAGGAGAAGAACAGAGTTGGAGG + Intronic
1111682588 13:91461803-91461825 AGGCAGAAGAAGGGTGTTGGTGG + Intronic
1111706477 13:91755628-91755650 ATGGGGAAGGAAAGTATTGTGGG + Intronic
1112116568 13:96361733-96361755 ATGGAGAAACTGAGTTTTGTTGG - Intronic
1112767089 13:102756830-102756852 ATGGAGAAGAAGAGGTTAGGGGG - Intronic
1112867280 13:103920252-103920274 CTGGAGGAGAAAATTGTTGTAGG + Intergenic
1115863683 14:37718491-37718513 ATGTTGAATAAGAGTGGTGTGGG - Intronic
1116453308 14:45088144-45088166 ATGGAGAAAAAGAATGCTGTTGG + Intronic
1117206476 14:53448857-53448879 ATGGAGGAGAAGAGAGCTGAGGG + Intergenic
1117222656 14:53621183-53621205 TGGGAAAAGAAGAGTGGTGTGGG - Intergenic
1118099866 14:62585273-62585295 TTGAAAAAGAAGAGAGTTGTAGG - Intergenic
1118365473 14:65091715-65091737 GCAGAGAAGAAGAGTGTTGCTGG - Intronic
1118875744 14:69783521-69783543 ATTGGGAAGAAGAGTGTTCCAGG + Intronic
1118905755 14:70022047-70022069 AAGGAGAAAAAGATTGATGTTGG - Intronic
1119569818 14:75660741-75660763 ATGGGGGAGAAGAGGGATGTAGG - Intronic
1119896012 14:78220551-78220573 ATGGAGATGATGAGTTTTGATGG + Intergenic
1120281306 14:82441905-82441927 AAGGAGAAAATGAGTGTTTTAGG - Intergenic
1120860177 14:89247962-89247984 ATGGAGGAGAAGAGCTTTCTAGG - Intronic
1120898436 14:89555392-89555414 ATGGAGAAGACTACTGTTGAGGG - Intronic
1121066958 14:90976590-90976612 ATGAACAACAAGACTGTTGTAGG - Intronic
1121282088 14:92706288-92706310 TGGGACAAGAAGAGTGTTCTGGG + Intronic
1121592855 14:95131863-95131885 ATGAAGAAGAAAGGTGGTGTAGG - Intronic
1122403714 14:101483768-101483790 GTGGAGAAGAACACTGTTGGTGG + Intergenic
1124121501 15:26892750-26892772 ATGGAGAAGAAGAGGATCGTGGG + Intronic
1124190177 15:27567845-27567867 ATGAAGAAGAAGAATCTTGGAGG + Intergenic
1124498601 15:30206492-30206514 ATGGATAAGAAGTGTGGAGTGGG - Intergenic
1124744980 15:32332184-32332206 ATGGATAAGAAGTGTGGAGTGGG + Intergenic
1124827501 15:33113508-33113530 ATGGAGGAGCAAACTGTTGTTGG - Intronic
1125312204 15:38392189-38392211 AAGGAGAAGAACAGAGTTGGAGG + Intergenic
1127307607 15:57723415-57723437 ATGGAGAGGGAGAGAGTTGGGGG - Intronic
1127978569 15:64017138-64017160 CTGGAGAAGAAGAGACTTGAAGG - Intronic
1128845378 15:70890184-70890206 ATGAAGAAGAAAAATGGTGTAGG + Intronic
1129258536 15:74348611-74348633 ATAGAGACAAAGCGTGTTGTTGG - Intronic
1129849916 15:78787921-78787943 AGGGAGAAGAATGGTGTTCTTGG - Intronic
1130433089 15:83868729-83868751 GTGGAGAAGCAGAGTGGTTTGGG + Intronic
1131209494 15:90481512-90481534 AAGGAGAGGAAGAGTCTTCTAGG - Intronic
1131558868 15:93422500-93422522 AAAGAGAAGAAAAGTGATGTGGG - Intergenic
1131868820 15:96740514-96740536 ATGGAGTAGAAGGGTGTGGAAGG - Intergenic
1134041689 16:11073582-11073604 TGGGAGAAGAGGAGTGTCGTGGG - Intronic
1134307556 16:13046819-13046841 ATGCAGAGGAAGAGTGGTTTAGG - Intronic
1134607792 16:15584743-15584765 ATGGAGAAGGCCTGTGTTGTAGG - Intronic
1135133706 16:19872565-19872587 AAGGAGAAGAAGAGCCCTGTGGG - Exonic
1136039015 16:27563350-27563372 ACGGAGCAGAAGAGGGATGTGGG + Intronic
1136096467 16:27960621-27960643 ATGGAGAAGCTGAGTGTGGTGGG + Intronic
1138438452 16:57020235-57020257 ATGGAGAACAGGTGAGTTGTGGG - Intronic
1138580248 16:57936317-57936339 ATGGAATAGAAGAGTAATGTGGG - Intronic
1138961224 16:62032709-62032731 ATGGACCAGAAAAGTGTGGTTGG + Intronic
1139134539 16:64185916-64185938 ATGTGGAAGAAGTATGTTGTTGG + Intergenic
1139228698 16:65259097-65259119 ATGAAGAAGGAGAGTGTTGAGGG + Intergenic
1140027236 16:71301732-71301754 ATGGAGAAGAGGAGGCTGGTAGG + Intergenic
1140220569 16:73040657-73040679 ATGGGGAAGAAGAGAATTGCTGG + Intronic
1140251803 16:73300912-73300934 GTGGAGAAGGAGACTGATGTTGG + Intergenic
1140794068 16:78419339-78419361 TTGAAAAAGAAGAGTGTTGGAGG + Intronic
1141657547 16:85424092-85424114 GTTCAGAAGAAGAGTGTTCTGGG + Intergenic
1145083541 17:19916102-19916124 ATGTGGAGGAAGAGTGTTCTTGG - Intronic
1146316495 17:31811423-31811445 ATGGAGATGAACAGTGGTGACGG + Intergenic
1146622882 17:34413627-34413649 ATGGAGGAGAACATTGTTCTAGG + Intergenic
1147250466 17:39150254-39150276 ATTGAGAAGAAGAGTATGTTGGG - Intronic
1147670241 17:42172871-42172893 ATGGAGAAGCATAGTGGAGTGGG + Intronic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1148935836 17:51164192-51164214 ATGGGGGAGAAGAGGGTAGTTGG + Intronic
1151637050 17:75356930-75356952 ATGGAGAAGAAAAGAGTTCCAGG - Intronic
1152264974 17:79288847-79288869 AGGGAGAAGTAGAGTGTTCTAGG + Intronic
1152873608 17:82772852-82772874 ATGGAGATGATGGGTGGTGTTGG + Intronic
1153174344 18:2353971-2353993 ATGAAGAGGAAGTGTGTTTTAGG - Intergenic
1153569895 18:6459700-6459722 AAGGAGAAGAAGAGAGATGGAGG - Intergenic
1153772336 18:8426002-8426024 ATGGAGATGCAGGGTTTTGTGGG + Intergenic
1153792280 18:8589438-8589460 AGTCAGAAGAAGAGTGTTATGGG - Intergenic
1153915191 18:9738620-9738642 ATGCAGATGAAGAGACTTGTAGG - Intronic
1156615922 18:38784038-38784060 ATGGAGATGAAGAATTTTTTAGG - Intergenic
1158127885 18:54122112-54122134 ATAGAGAAGAAGAGGTTTGATGG + Intergenic
1161390640 19:4018685-4018707 AAGGAGCAGCAGAGTGATGTAGG + Intronic
1161461773 19:4401925-4401947 AAGGAAAAGAACAGTGTTGTAGG + Intergenic
1168501640 19:56898128-56898150 ATGGAAAACAAGAGAGATGTGGG + Intergenic
925192230 2:1893865-1893887 ATGGGGAAGAGGTGTGTTATTGG + Intronic
925282647 2:2695555-2695577 ATGGATGAGAAGATTGTGGTAGG - Intergenic
925290123 2:2742239-2742261 ATTGATGAGAAGAGTTTTGTTGG + Intergenic
925327867 2:3036917-3036939 ATGGAGCAGAAGTGAGTTGATGG - Intergenic
925797554 2:7563314-7563336 AGGGAAAAAAAGAGCGTTGTTGG - Intergenic
926564363 2:14453503-14453525 CAGAAGAAGAAGAGGGTTGTAGG - Intergenic
926877471 2:17497814-17497836 AAGCAGAAGCAGAGTGTTGTAGG - Intergenic
926932326 2:18052945-18052967 ATGGTGAAAAAGAGTGATGGTGG + Intronic
927020301 2:19009822-19009844 ATGAAGGAGAAAAGTGTGGTTGG + Intergenic
928328436 2:30338417-30338439 ATGGAGAATAAGGGTGTTTTTGG + Intergenic
928425210 2:31172104-31172126 AAGGAGGAAATGAGTGTTGTGGG - Intergenic
930837226 2:55807245-55807267 ATGCAGAAGAGGAGTGCTGAAGG - Intergenic
931691513 2:64838199-64838221 ATGGAGAGGAAGTGTGCTGGAGG - Intergenic
931895265 2:66721756-66721778 AAGGAGAAGAAGAGAGATGAGGG - Intergenic
932213786 2:69953154-69953176 ATGGGGAAGAAAAGTGTCTTGGG - Intergenic
932346054 2:70995650-70995672 ATGTAGAACAAGAGTCTAGTAGG + Intergenic
933493009 2:83012342-83012364 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
935387196 2:102512730-102512752 ATGGTGAAGAAGAGGGATTTGGG - Intronic
935574213 2:104692207-104692229 ATGGAGATGAATAGTGGTGATGG - Intergenic
935660221 2:105460464-105460486 ATGGAGAAGAAAAATGTAGGAGG + Intergenic
936756091 2:115714535-115714557 TTGGAGAACAAGAGAGATGTAGG - Intronic
936963815 2:118105705-118105727 ATGGTGAAAAAGAGTGTTAAAGG + Intronic
937501914 2:122488391-122488413 ATGGGGAAGAGGTTTGTTGTTGG - Intergenic
938781896 2:134592052-134592074 AGGGAGAAGGAGAGTGTTACAGG + Intronic
938791068 2:134676622-134676644 AAGGACAAGAAGAATGTTTTGGG - Intronic
939128514 2:138205708-138205730 ATGGAGAAGAAGAGCTTGTTGGG - Intergenic
939428071 2:142066614-142066636 GAGGAGATGAAGAGTGTGGTAGG - Intronic
939989560 2:148864611-148864633 ATGGGAGAGAAGAGTGATGTGGG + Intergenic
941195293 2:162443367-162443389 AGGGAGAAAAAGTGTGTTGTGGG - Intronic
941407322 2:165106798-165106820 AAGAAGAAAAAGAGTGATGTAGG + Intronic
942802797 2:179895081-179895103 AGGGAGTAGAAGAGTGCTGCTGG - Intergenic
943234313 2:185298726-185298748 AAGGAGAAGAACAGTGTTTAGGG - Intergenic
943264961 2:185717578-185717600 TTGAAGAAGGAGAGTGTTTTAGG - Intergenic
943792384 2:191948042-191948064 TTGGAGATGAAGAGAGTTGCAGG + Intergenic
945863662 2:215152568-215152590 ACAGAAAAGAAGACTGTTGTAGG - Intergenic
946744372 2:222831018-222831040 ATGAAGAGGAAGAGTGGTCTAGG - Intergenic
947660810 2:231865857-231865879 ATGGAGAAGAACTGTGATGTTGG - Intergenic
947932943 2:233978979-233979001 CTGAAGAAGCAGAGTGATGTGGG + Intronic
948104456 2:235401888-235401910 CTGGAGAAGGAGAAAGTTGTAGG - Intergenic
1168879685 20:1195906-1195928 ATGGAGAAGGTGAGTGTTGAGGG + Intergenic
1170638490 20:18130325-18130347 ATGGAGATGAATAGTGATGCTGG + Intergenic
1170956729 20:20987630-20987652 ATGAAGAAGAACAGGGTTGGAGG + Intergenic
1171212008 20:23324445-23324467 ATGGAGAAGAAGAAGGTTTGTGG + Intergenic
1172064806 20:32211704-32211726 GTGGCGAAGAAGAGCCTTGTTGG - Intronic
1172197997 20:33105221-33105243 ATGGAGAAAAAGAGTTTAGAAGG - Intronic
1173563289 20:44021437-44021459 AAGGAGAAGAGGAGTCCTGTGGG - Intronic
1174160875 20:48549555-48549577 ATGGAGAACAGGAGTGGAGTTGG - Intergenic
1174865733 20:54134020-54134042 ATCTAGAGGAAGAGTGTTCTGGG + Intergenic
1175208591 20:57330893-57330915 TTGGAGAAAAAAAGTGTTGCAGG - Intronic
1175254913 20:57636128-57636150 AGGGAGAAGAAAAATGATGTAGG + Intergenic
1179095686 21:38312577-38312599 ATGGGAAAGAATAGTGTTATGGG - Intergenic
1179900219 21:44388468-44388490 ATGGAGAAGGACAGTGATGATGG + Intronic
1179958691 21:44756047-44756069 ATGGAGAAGAAGAGGGAGGAGGG + Intergenic
1181548842 22:23623700-23623722 TTGGAAAAGAATAGTGTTGGTGG + Intronic
1181891951 22:26070978-26071000 CTGGAGAAGAAGAGTATTGTGGG - Intergenic
1182795361 22:32987700-32987722 ATAGAGAAGGAGATTTTTGTGGG + Intronic
1182841973 22:33398410-33398432 ATAGAGAAGCAGAGAGTTGGAGG - Intronic
1182959396 22:34457939-34457961 ATGGAGATGAAAGGTGTGGTTGG + Intergenic
1183052655 22:35276738-35276760 ATGGTAAAGAAGTATGTTGTGGG - Intronic
1184178238 22:42801908-42801930 ATGGGGAAGAAGAGCATTCTGGG + Intronic
1185031959 22:48448863-48448885 ATGGGAAGGAAGACTGTTGTTGG - Intergenic
951424623 3:22529468-22529490 ATGCAGAAAAACAGTATTGTTGG - Intergenic
951473020 3:23076764-23076786 GAGGTGAAGAAGAGTGTAGTGGG + Intergenic
952088098 3:29850988-29851010 ATGAGGAAGAAAAGTGTTGTAGG - Intronic
953538005 3:43790465-43790487 GTGGGGAAGAAGAGTGTGGTGGG - Intergenic
953663680 3:44909855-44909877 ATGGAGAAGCAGATTTTTGGAGG + Intronic
956188718 3:66587326-66587348 ATGGAAAATAACAGTGTTGGTGG + Intergenic
956253736 3:67261794-67261816 ATGGAGAATAGGAGTGTTAATGG - Intergenic
956902450 3:73730744-73730766 ATAAAGGAGAAGAGTGTTGCAGG + Intergenic
956929042 3:74021682-74021704 GTGGACAAGGAGAGTGATGTTGG - Intergenic
958052233 3:88363066-88363088 AGGGAGAGTAAAAGTGTTGTGGG - Intergenic
958097003 3:88959189-88959211 ATGGAAAATAATAGTGTGGTTGG + Intergenic
960792550 3:121449799-121449821 AAGGACAAGAAGAGGGATGTTGG - Intronic
961084244 3:124052946-124052968 ATGGAGAATTAGAGGATTGTAGG + Intergenic
961159650 3:124712852-124712874 ATGGATAAGTAAAGTTTTGTGGG - Intronic
961424167 3:126831801-126831823 ATCAAGAAGAAGAGTGTGTTTGG + Intronic
962534340 3:136314357-136314379 ATGGAGAAGAAAAGTGGAATTGG + Intronic
964154164 3:153564453-153564475 ATGGAGAGGAAATGTGTGGTTGG + Intergenic
965275746 3:166679634-166679656 ATGGAGAAGGACGGTGTGGTTGG - Intergenic
966912342 3:184566480-184566502 CTGGAGAAGATGCATGTTGTGGG - Intronic
967135206 3:186507288-186507310 ATGGAGAGGAAGAGTCAAGTGGG + Intergenic
967344644 3:188441268-188441290 ATGGTGAAGATTACTGTTGTAGG - Intronic
967700303 3:192584864-192584886 ATGGAGGGGCAGAGTTTTGTTGG - Intronic
968056870 3:195698414-195698436 ATGGATAGGAAGAGAATTGTGGG - Intergenic
971090622 4:23340535-23340557 AAGGAGAAGAAGAAAGTTGGAGG + Intergenic
971478664 4:27095264-27095286 ATGGAGAAGGAGAGGCTGGTGGG - Intergenic
971600656 4:28587132-28587154 ATGAGGAAGAAGAGTGATCTAGG - Intergenic
972629711 4:40832761-40832783 ATGGAGCTGCAGAGTGTTGAGGG - Intronic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973530398 4:51831948-51831970 ATGGGAAAGCAGACTGTTGTTGG + Intergenic
973783115 4:54308918-54308940 ATAGAGAAGAAAACTGTGGTAGG + Intergenic
975231710 4:71942614-71942636 AAGGAGAAGAACAGAGTTGGAGG + Intergenic
976600039 4:86929638-86929660 ATCTAGAAGGAGAGTGTGGTAGG - Intronic
977063423 4:92284223-92284245 ATGGAGAAGTAGGGGGTGGTAGG - Intergenic
978157454 4:105506095-105506117 ATTGAGAAGGAGCATGTTGTGGG - Intergenic
978363230 4:107953179-107953201 ATTGAGAAGAAGTCTGTTCTTGG + Exonic
978780924 4:112553166-112553188 ATGGAGTAAAAGAAAGTTGTTGG - Intronic
978833771 4:113121867-113121889 ATGAACAAGAAGAATGTGGTGGG - Intronic
980387565 4:132106059-132106081 ATGAAGAAGAAGATTGATATTGG + Intergenic
980974775 4:139599937-139599959 AGGAAGAAGAAGAGTGTTTCAGG - Intronic
981678504 4:147366844-147366866 ATGGAGAAGGTGAGAGATGTAGG + Intergenic
981849510 4:149212955-149212977 TTGGAAAACAAGAGTTTTGTGGG - Intergenic
982142605 4:152341231-152341253 ATGGGAAAGTAGTGTGTTGTAGG - Intronic
983363039 4:166751072-166751094 ATGGAGAAGAAAAGTGATTAAGG - Intronic
983847330 4:172536476-172536498 ATGGAGATGAGGAATGTTTTGGG + Intronic
984207745 4:176806504-176806526 ATGAACAAGAAGAAAGTTGTAGG + Intergenic
986688640 5:10295814-10295836 AATGAGAAGCAGAGTGTTGTGGG - Intronic
986723420 5:10576951-10576973 ATGGAACAGAAGCCTGTTGTGGG + Intronic
986748756 5:10766374-10766396 ATGGAGAAGAGAAGGATTGTTGG + Intergenic
987504956 5:18755916-18755938 ATGGAGAAAAAGAGGATTTTTGG + Intergenic
988987957 5:36639096-36639118 CTGGAGAAGCAGTGTGTGGTAGG + Intronic
989173766 5:38499949-38499971 ATCTAGGAGAAGAGAGTTGTAGG - Intronic
990320820 5:54628340-54628362 AGGGAGAAGAATAGTGCAGTGGG - Intergenic
990504135 5:56427834-56427856 AAGGGGAAGGAGAGTGTTGCAGG - Intergenic
990703588 5:58501803-58501825 ATGCACAAGAAGAGTGATGCTGG - Intergenic
992425183 5:76649758-76649780 ATGGAGGAGAAGTGTGGGGTTGG - Intronic
992457645 5:76930803-76930825 AAGGAGAAGAAGAGTGTTTGAGG + Intergenic
993007707 5:82446209-82446231 AGGAAGAAGAAAAATGTTGTTGG + Intergenic
993459444 5:88165199-88165221 ATGGACAAGAGTATTGTTGTTGG + Intergenic
993543303 5:89179714-89179736 AGGAAGAATAAGAATGTTGTGGG + Intergenic
994123025 5:96138411-96138433 AAGAAGAAGAACAGTGTTGGAGG - Intergenic
994535597 5:101025923-101025945 ATGGAGATGAAGAGTTTATTGGG - Intergenic
995245210 5:109927636-109927658 AAGGAGAAGGAGACTGTTGGAGG - Intergenic
995829411 5:116337117-116337139 CAGGAGTAGAAGGGTGTTGTAGG + Intronic
996314447 5:122146043-122146065 CTGGAGTAGAGGAGTGTTGCTGG + Intronic
996744307 5:126832855-126832877 ATGAAGACCAAGAGTGTGGTTGG + Intronic
997546705 5:134714057-134714079 ATGGAGAAGAAAAAAGTTATGGG - Intronic
999241129 5:150128039-150128061 AGGGAGGAGAAGAGGGATGTTGG - Intronic
999857332 5:155608929-155608951 CTGGAGAAGAAGAGTGGGATGGG + Intergenic
1000228145 5:159289814-159289836 ATGGAGAAGAATATTGTGGAAGG + Intergenic
1000475039 5:161696536-161696558 ATGGATTAGACGAGGGTTGTAGG + Intronic
1001597418 5:172907097-172907119 ATGGAGAGGAGGAGGGCTGTAGG - Intronic
1003367433 6:5488631-5488653 ATGGAGCATAAGAGTTTAGTTGG + Intronic
1004355498 6:14926781-14926803 ATGGAACTGAAGAATGTTGTTGG - Intergenic
1005228491 6:23671555-23671577 ATTGAGAAGAAAAGTGGGGTTGG - Intergenic
1006243578 6:32708605-32708627 GTGGAGAAGAAGTTTATTGTGGG - Intergenic
1006935354 6:37713480-37713502 ATGGAGGAGATGAGAGTTGGAGG - Intergenic
1007112687 6:39322202-39322224 ATTTGGAAGAAGAGTGTGGTGGG - Intronic
1009900066 6:69799297-69799319 ATGGACAAGGAGAGTGTCCTCGG - Intergenic
1011799110 6:90991034-90991056 ATAGGGAAGCAGAGTCTTGTAGG + Intergenic
1012817690 6:104044755-104044777 ATGGAGAAGAATAATCTTTTTGG + Intergenic
1013713925 6:112934977-112934999 AGGAGGAAGAAGAGTGTTCTAGG - Intergenic
1014762563 6:125373266-125373288 ATGGAGAAGAAGAGTTTGGGAGG - Intergenic
1015150846 6:130035407-130035429 TTGGAGATGAGGAGTGGTGTAGG + Intronic
1015270568 6:131333854-131333876 GTGGAGAAGAGGACTGTGGTTGG + Intergenic
1015409268 6:132873780-132873802 ATGGGGAAAAAGAAAGTTGTAGG - Intergenic
1015590251 6:134816256-134816278 ATGGACTAGGAAAGTGTTGTAGG + Intergenic
1016943527 6:149505651-149505673 ATGAAGAAGAAGAAAGCTGTTGG - Exonic
1017143900 6:151216619-151216641 AGGGAGAGGAAGAGCTTTGTAGG + Intergenic
1017786482 6:157761060-157761082 AAGGAGAAGGAGAGAGCTGTGGG + Intronic
1018071284 6:160166764-160166786 ATGGAGGAGATAAGAGTTGTTGG + Intergenic
1019106618 6:169672971-169672993 ATGGAGCAGACGAGTGTTGGGGG + Intronic
1021110135 7:16684293-16684315 TTGGAGATGGAGACTGTTGTAGG + Intronic
1021752567 7:23818201-23818223 ATGGAGAAAAAGAGTTGTGGGGG - Intronic
1021910747 7:25383997-25384019 ATGGAGAAGAAGAGACTATTGGG - Intergenic
1021920399 7:25479332-25479354 AACGAGAAGGAGATTGTTGTGGG + Intergenic
1022077271 7:26984582-26984604 CTGAAGAAGAAGAGTGATCTTGG - Intronic
1023187442 7:37547152-37547174 CGGGAGAAGAAGAGTGTTCTGGG - Intergenic
1024904453 7:54360729-54360751 ATGGTGATGAAGTGTGATGTGGG + Intergenic
1025629538 7:63257292-63257314 ATGGAGTAGAAGAGTAAGGTTGG + Intergenic
1025652731 7:63486746-63486768 ATGGAGTAGAAGAGTAAGGTTGG - Intergenic
1026311928 7:69193498-69193520 ATGGATAAACAGAGGGTTGTTGG + Intergenic
1027161175 7:75803511-75803533 ATGCAGAAGAAGAGGGTAGCAGG - Intergenic
1027297125 7:76788197-76788219 ATGGAGAAGAGAAGTGGAGTGGG - Intergenic
1027483753 7:78732892-78732914 CTGGAGCAGAGGATTGTTGTTGG + Intronic
1027618024 7:80448268-80448290 AGGGAGAAGAAGAATGTTCTGGG + Intronic
1027987191 7:85308409-85308431 ATGGAGCAGATGACTGCTGTGGG - Intergenic
1028406465 7:90480283-90480305 AGGGAAAAGAAGAGTGTTAAAGG - Intronic
1028700922 7:93778385-93778407 TTAGAGAAGAATAGTGTTTTAGG - Intronic
1030958245 7:115882339-115882361 ATGGAACAGAAGAGTTTTCTGGG - Intergenic
1030979562 7:116170597-116170619 ATTGGGAAGAAGGGTGTTGGGGG + Intergenic
1031066589 7:117112233-117112255 ATGTAAAAGAAGTGTGTTTTTGG + Intronic
1032142401 7:129344692-129344714 TTGGAAAAGAAGACTGTTGATGG + Intronic
1032439167 7:131928682-131928704 CTGGAGAAGAAAAGTGTCATAGG + Intergenic
1032701315 7:134381889-134381911 ATGGAGAAAAAGACTGGTATGGG - Intergenic
1032943596 7:136824254-136824276 AAGGACATGAAGAGTCTTGTGGG - Intergenic
1034040305 7:147870725-147870747 AAGGACAAGAAGTGTATTGTTGG - Intronic
1034080612 7:148274585-148274607 ATCCAGAGGAAGAGTGTTGGGGG - Intronic
1034101954 7:148457841-148457863 ATGGGGGAGAAGGGTGTGGTTGG - Intergenic
1036012928 8:4748151-4748173 ATGGAGTAGAAACATGTTGTGGG - Intronic
1037569916 8:20149399-20149421 AAGGAGAGGAAGAGGGCTGTAGG - Intronic
1037873603 8:22524483-22524505 AGGGAGAAGCAGAGCATTGTAGG - Intronic
1038552146 8:28479433-28479455 GTGGAGAAGAAAAGTGTCTTAGG - Intronic
1038746869 8:30262300-30262322 AGGGAGCAGTAGAGTGTTTTGGG + Intergenic
1039233195 8:35472213-35472235 ATGGTGAAGCAGAGTTGTGTAGG + Intronic
1039333929 8:36569296-36569318 AGGGAGAGGAAGAGTGTTTTGGG - Intergenic
1040387487 8:46923365-46923387 ATGGAGAGGAAGGGTGTGCTCGG + Intergenic
1040391311 8:46953126-46953148 ATGTAAAAGAAGAGTATTGGGGG + Intergenic
1040568639 8:48589114-48589136 AGGGAGAAGAAGGGTGGTGATGG - Intergenic
1040897540 8:52384436-52384458 ATGGAGAGGATGAGTGAAGTGGG - Intronic
1041354181 8:56982679-56982701 AAGGACAGAAAGAGTGTTGTTGG + Intronic
1042648107 8:71009655-71009677 ATGGGGAAGAAGAGTGCTGAGGG + Intergenic
1042693662 8:71531806-71531828 ATGGAGAGGAGGAGGTTTGTGGG - Intronic
1044509658 8:93059819-93059841 ATGGACAAGAATACTTTTGTAGG + Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1047154516 8:122301943-122301965 TAGGAGAAGAACAGTGATGTGGG + Intergenic
1047540285 8:125758652-125758674 ATTGATAGGAAGATTGTTGTTGG - Intergenic
1047783933 8:128135427-128135449 CTGGAGAAGAAGTGTGATGAAGG - Intergenic
1047897893 8:129386768-129386790 AGGTAAAATAAGAGTGTTGTCGG - Intergenic
1048676408 8:136787924-136787946 ATCAAGTAGAAGAGTGTAGTCGG - Intergenic
1048695361 8:137021910-137021932 ATGAAGAAGAAGAGGGTTATTGG + Intergenic
1048726780 8:137395041-137395063 ATGCTGAAGAACAGTGGTGTAGG + Intergenic
1048941464 8:139404138-139404160 GTGCAGAAGCAGAGTGATGTGGG + Intergenic
1050206310 9:3200007-3200029 TTGAGGAAGAGGAGTGTTGTGGG - Intergenic
1050226185 9:3458502-3458524 ATGGAGTAGAAGAGTAATGGAGG + Intronic
1050308602 9:4330561-4330583 ATGGAGATGAAGAGAGGTGGAGG + Intronic
1051415280 9:16833283-16833305 ATTGTCAAGAAGAGTGTTTTTGG - Intronic
1052416752 9:28187574-28187596 ATGAAGAAGAAGACTGTAGGAGG + Intronic
1053011591 9:34636901-34636923 ATGGAAAAGGAGTGTGTTGGGGG - Intronic
1053289278 9:36869320-36869342 AGGGAGAAGATGAGTGTTTCAGG - Intronic
1055916925 9:81412711-81412733 ATGTACAAGAAGAGTTTTGTAGG + Intergenic
1056066296 9:82938936-82938958 AAGGAGTAGAAGAATGATGTAGG - Intergenic
1056305292 9:85284895-85284917 ATGTGGAAGAGTAGTGTTGTGGG + Intergenic
1057229467 9:93310994-93311016 ATGGAGATGAACAGTGGTGGTGG - Intronic
1058703921 9:107623448-107623470 ATGAAGAAGAAAAGTGGTGTTGG - Intergenic
1058743386 9:107966429-107966451 ATGGGAAAGAACAGTGTTCTGGG - Intergenic
1058772676 9:108251882-108251904 AAGGAGAAGAACAAAGTTGTAGG - Intergenic
1058805744 9:108589800-108589822 ATGGAGAACAAGAGTGAAGAAGG + Intergenic
1058875356 9:109239308-109239330 AGGCAGAAGAAAAGTTTTGTGGG + Intronic
1059531774 9:115042176-115042198 AGAGAGAGGAGGAGTGTTGTGGG - Intronic
1059729674 9:117044414-117044436 ATGGAGCAGCAGAGGGGTGTGGG + Intronic
1060100303 9:120834471-120834493 ATCCAGAAGAAAAGTGTTCTAGG + Intronic
1062177757 9:135173640-135173662 GTGGAGATGATGCGTGTTGTGGG + Intergenic
1062205756 9:135335981-135336003 ATGGGGATGAAGGGTGCTGTGGG - Intergenic
1186204395 X:7186335-7186357 ATGGACAAGGAGAGTGTTCTGGG + Intergenic
1187671463 X:21670074-21670096 TTGAAGAAGAAGAATGTTGGAGG - Intergenic
1187816111 X:23233744-23233766 AAGGAGAAGCAGTGTTTTGTCGG - Intergenic
1188325068 X:28791924-28791946 AAGTAGAAGAGGAGTGTAGTTGG + Intronic
1188883041 X:35513607-35513629 ATAGAGAAGAAGAGATGTGTGGG - Intergenic
1189926173 X:45957948-45957970 ATCTGGAAGAAGAGTGTTCTAGG + Intergenic
1190546250 X:51530872-51530894 ATGGAGGAGGAGAGTGTGGGGGG - Intergenic
1192470133 X:71391221-71391243 ATGGAGGAGTAGTGTGTAGTTGG + Intronic
1195533772 X:105987166-105987188 ATAGAGAAGAAAAGTGGTCTAGG + Intergenic
1197890094 X:131261762-131261784 TAGGTGAAGAAGAGAGTTGTAGG + Intergenic
1198232099 X:134700003-134700025 ATTCAGAAGGAGAGTGTTCTGGG - Intronic
1198774295 X:140163258-140163280 AGGGAGAGGAAGAGTTCTGTGGG - Intergenic
1198840833 X:140855939-140855961 ATGGTGAAGCATAGTGCTGTAGG - Intergenic
1199320139 X:146428296-146428318 AGGGAGAAGAAGGGTGGTGTGGG - Intergenic
1199593025 X:149485521-149485543 GAGGACAAGAAGAGTGTTGAAGG + Intronic