ID: 924250935

View in Genome Browser
Species Human (GRCh38)
Location 1:242132539-242132561
Sequence TTTATATTCTGAGTTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 294}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924250934_924250935 -8 Left 924250934 1:242132524-242132546 CCAGTTAGCTGCTGATTTATATT 0: 1
1: 0
2: 0
3: 16
4: 262
Right 924250935 1:242132539-242132561 TTTATATTCTGAGTTGCTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 294
924250933_924250935 20 Left 924250933 1:242132496-242132518 CCTGCAACTGGGAGCAGCTCACA 0: 1
1: 0
2: 0
3: 19
4: 193
Right 924250935 1:242132539-242132561 TTTATATTCTGAGTTGCTGCAGG 0: 1
1: 0
2: 2
3: 19
4: 294

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924250935 Original CRISPR TTTATATTCTGAGTTGCTGC AGG Intronic
902085676 1:13859617-13859639 TTAATATTTTTAGTTGCTTCTGG + Intergenic
902844106 1:19095946-19095968 TTTAGGGTCTGAGTTGATGCTGG - Intronic
902975166 1:20083210-20083232 TTGGGATTCAGAGTTGCTGCTGG + Intronic
905781803 1:40717726-40717748 TTTATTTTTTGAGTTGCTTTGGG + Intronic
906997312 1:50810723-50810745 TTTATATTCTGAAATGTTGCTGG - Intronic
907756752 1:57318143-57318165 TTTTTTTTTTGAGTTGCAGCTGG - Intronic
908829439 1:68164671-68164693 TTCAAATTCTGAGTGGCTTCAGG - Intronic
912558408 1:110532861-110532883 TTTATCTTTTCATTTGCTGCTGG + Intergenic
912781236 1:112550306-112550328 TTTATTTTCTGAGTTTGTGAAGG + Intronic
913007100 1:114645228-114645250 GTCATATTCTGAGGTGCTGGGGG - Intronic
913289969 1:117262887-117262909 ATGATATTATGAGCTGCTGCTGG + Intergenic
915530960 1:156501676-156501698 TTTATATTCCTGGTTGCTCCAGG + Intergenic
917250215 1:173051110-173051132 TTTATGTTCTGAGTTTGTGTTGG - Intergenic
922788506 1:228295894-228295916 TTTTGATTTTGAGTTGATGCTGG - Intronic
922944521 1:229500946-229500968 TTTAGATTCTGACTCACTGCTGG + Intronic
923773827 1:236960674-236960696 TTTCGATTCTGAAATGCTGCAGG - Intergenic
924250935 1:242132539-242132561 TTTATATTCTGAGTTGCTGCAGG + Intronic
1063009319 10:2007210-2007232 TATATTTTCTGAGTTTTTGCAGG - Intergenic
1063810444 10:9699144-9699166 TTTATATACAGAGATGCTACTGG + Intergenic
1063859609 10:10293410-10293432 TTTATTTTTTAAGTTGCAGCAGG + Intergenic
1064711379 10:18129765-18129787 TTTATGTTGTGAGTTGCAGAGGG - Intergenic
1065371999 10:24996847-24996869 GTTATATTCTGAGATACTGGGGG - Intronic
1065607382 10:27432125-27432147 TTTTAATTCTGATGTGCTGCTGG - Intergenic
1066143771 10:32535168-32535190 TTTATGTTCTGGGTTGTTGCTGG + Intronic
1067163149 10:43843859-43843881 TTCAAATTCTGAGTTGCTTTTGG + Intergenic
1070674137 10:78400276-78400298 TTTATATTCTTAGATACTCCTGG - Intergenic
1071954123 10:90738782-90738804 TTTGTTTTTTAAGTTGCTGCTGG - Intergenic
1072127686 10:92461846-92461868 TTTATATTCTTAGTAGATACGGG + Intronic
1072946369 10:99813299-99813321 TTTATATAATCAGTTGCTGGGGG + Intronic
1075285841 10:121185167-121185189 TTTGTATCCTGTGTTGCTACAGG - Intergenic
1077399888 11:2349725-2349747 TTTACATTCTGTGTGGCTGCAGG - Intergenic
1077926238 11:6684108-6684130 GTCACATTCTGAGTTACTGCAGG - Intergenic
1080274356 11:30487145-30487167 TTTTAATCCAGAGTTGCTGCTGG - Intronic
1080657141 11:34266920-34266942 TTTATTTTCTGAGTGGCCTCTGG - Intronic
1081134345 11:39420321-39420343 TTTATAATCTGTGTTTCTACAGG - Intergenic
1084238409 11:67803016-67803038 ATCAGATTCTGAGCTGCTGCGGG - Intergenic
1084577567 11:69999554-69999576 GTTATGTTCTCAGATGCTGCTGG - Intergenic
1084833999 11:71789809-71789831 ATCAGATTCTGAGCTGCTGCGGG + Exonic
1085531837 11:77196401-77196423 GTTACATTCTGAGTTGCTGGGGG + Intronic
1086109768 11:83187227-83187249 TTTATATTTTGAGTAGAGGCGGG + Exonic
1086251507 11:84820380-84820402 TTTATCTTCTACATTGCTGCTGG + Intronic
1088299900 11:108345986-108346008 TCTACATTCTGAGTTGCAGGGGG + Intronic
1088300065 11:108348937-108348959 TCTACATTCTGAGTTGCAGGGGG - Intronic
1090666852 11:128920099-128920121 GTTCTATTCTGAGTTCCTGGAGG - Exonic
1090908666 11:131098931-131098953 TTTATATTGGGGGTTGATGCTGG + Intergenic
1091062377 11:132475415-132475437 GTCATATTCTGAGATGCTGGAGG - Intronic
1092409096 12:8240656-8240678 ATCAGATTCTGAGCTGCTGCGGG - Intergenic
1093806753 12:23442880-23442902 TATATAATCTGAGTAGCTGAGGG - Intergenic
1094080828 12:26533535-26533557 GTTATATTCTAAGGTGTTGCAGG - Intronic
1095503636 12:42868396-42868418 TTTTTTTTCTGGGTTGCTGAGGG + Intergenic
1097440832 12:59605952-59605974 TTTATTTTATGAGTTGTTGTTGG + Intronic
1097703226 12:62841330-62841352 TTTATATTTTAAGTAGCTGGGGG + Intronic
1098478528 12:70934879-70934901 TTTATAATCTGCTATGCTGCAGG - Intergenic
1099669963 12:85678716-85678738 TTTATATTTTTAGTTATTGCTGG + Intergenic
1099987976 12:89690496-89690518 TTGACATTCTGAGTTGATTCAGG - Intronic
1100120425 12:91363383-91363405 ATCATATTCTGAGATGCTGGAGG + Intergenic
1100819863 12:98420833-98420855 ATCATATTCTGATTTGGTGCAGG + Intergenic
1101493311 12:105230154-105230176 TTTATGTCCAGAGCTGCTGCTGG - Intronic
1102722774 12:115032397-115032419 TTCACATTCTGAGGTGCTGGAGG - Intergenic
1102873224 12:116430178-116430200 CTTGTATTCAGTGTTGCTGCGGG - Intergenic
1104254903 12:127127502-127127524 GTTATATTCTGAGGTCCTGAAGG + Intergenic
1104518004 12:129445776-129445798 TTTGTATTCTTACTTGTTGCAGG + Intronic
1105997056 13:25682599-25682621 GTTATTTGCTGAGTTTCTGCAGG + Intronic
1106203678 13:27567901-27567923 TTTATATTCTGATTATCTTCAGG + Intronic
1108297941 13:49043836-49043858 TTAATCTTTTGAGTTGCTGAAGG - Intronic
1108768389 13:53663522-53663544 TTTGTATTCTGCATAGCTGCAGG - Intergenic
1109434687 13:62283915-62283937 TTTATATTTTGTGTGCCTGCAGG + Intergenic
1109952595 13:69518553-69518575 GTTATATTCTGAATGGCTTCTGG - Intergenic
1111395268 13:87659388-87659410 TTTATATTATTAGTTGTTACAGG - Intergenic
1111585105 13:90273378-90273400 TTGGTCTTCTGGGTTGCTGCAGG + Intergenic
1114338438 14:21716804-21716826 TTTGCATTCTGAGGTGCTGACGG - Intergenic
1116449366 14:45047882-45047904 TTTATATTTTGAGTAGAGGCGGG - Intronic
1116777777 14:49201541-49201563 TTTATATTCTGAGGTACTGGGGG - Intergenic
1116997636 14:51340339-51340361 TTTACATTCTGAGATCCTGGGGG + Intergenic
1119848933 14:77852168-77852190 TTTATATTCTTAGTAGAGGCGGG + Intronic
1120079647 14:80201459-80201481 TATATATTCTCAGCTGCTGCGGG - Intronic
1120564600 14:86038990-86039012 TTTGGATTTTGAGTTGGTGCTGG + Intergenic
1122504039 14:102220279-102220301 TTTACATACTTAGTGGCTGCAGG - Intronic
1123427864 15:20187527-20187549 TGTATAGACTGAGATGCTGCTGG - Intergenic
1123792416 15:23735261-23735283 TTTATATTCTGATTTTCACCTGG + Intergenic
1125896333 15:43305505-43305527 TTTATAAATTGAGTTGCTGCAGG - Intergenic
1126366583 15:47900919-47900941 TTTATAGGCTGTGTTGCTGCAGG + Intergenic
1126420051 15:48462928-48462950 TTTAAATTCACAGTTGGTGCTGG - Intronic
1126850406 15:52793310-52793332 CTTAGATTTTGAGTAGCTGCAGG + Intergenic
1127132499 15:55882155-55882177 TTTAAATTTTGTGTTTCTGCAGG - Intronic
1129716495 15:77854491-77854513 TTTTTATTCTCAGTTGCTGGTGG - Intergenic
1130189703 15:81722075-81722097 GTTATATTCTGAGGTTCTGGGGG - Intergenic
1131093443 15:89641087-89641109 GTCATATTCTGAGGTGCTGGTGG - Intronic
1131519693 15:93104471-93104493 GTTTTATTCTGCATTGCTGCAGG - Intergenic
1131794535 15:96001598-96001620 TTTAAATTCTATGGTGCTGCTGG + Intergenic
1132617627 16:849815-849837 TTTATTTTCTGTGTTGTTGCCGG + Intergenic
1133350065 16:5095466-5095488 ATCAGATTCTGAGCTGCTGCGGG - Exonic
1133417996 16:5621338-5621360 CTCACATTCTGAGTTGCTGGGGG + Intergenic
1134914012 16:18054055-18054077 TCTTTACTCTGAGTTGCTGAGGG + Intergenic
1135353816 16:21752852-21752874 TTTTTTTTCTGAGTTGATGAAGG + Intronic
1135452305 16:22568990-22569012 TTTTTTTTCTGAGTTGATGAAGG + Intergenic
1135513686 16:23111414-23111436 TTTATTTTCTGTCTTGATGCAGG - Intronic
1136856431 16:33662234-33662256 TGTATAGACTGAGATGCTGCTGG + Intergenic
1140077381 16:71714109-71714131 TTTATATTTTTAGTAGCAGCAGG + Intronic
1140337734 16:74125349-74125371 TTTATATTATGGGTTGCTTTTGG - Intergenic
1140825816 16:78705292-78705314 TTTATATTCATTGTTGCTTCCGG + Intronic
1140904049 16:79395396-79395418 CTTATATTCTGAGGTTCTGGTGG - Intergenic
1203118011 16_KI270728v1_random:1510711-1510733 TGTATAGACTGAGATGCTGCTGG + Intergenic
1143464875 17:7129938-7129960 TTTTTTTTCTGGGTTGGTGCTGG - Intergenic
1146646547 17:34580577-34580599 TTTTTATGCTGGGCTGCTGCAGG + Intergenic
1149802285 17:59580908-59580930 TTTATATTTTCAGTAGCTACGGG - Intronic
1149844206 17:59994581-59994603 TTTATATTTTCAGTAGCTACAGG + Intergenic
1149863615 17:60138438-60138460 TATATATTTTGAGCAGCTGCTGG + Intergenic
1151357268 17:73567295-73567317 TTTGTATTCTGTGTGCCTGCAGG - Intronic
1153939503 18:9966062-9966084 ATTATATTCTGATTTCCTTCTGG + Intergenic
1154098827 18:11448757-11448779 TTAATATTTTGATGTGCTGCTGG - Intergenic
1154164644 18:12005602-12005624 CTTATATTAATAGTTGCTGCTGG + Intronic
1155262089 18:24052978-24053000 TTTATAATCTGATTTGTAGCAGG + Intronic
1155698139 18:28709102-28709124 TTAATATTCTGAGTTCATTCAGG + Intergenic
1155879869 18:31132031-31132053 TTCACATTCTGAGTTACTGAGGG - Intronic
1156360786 18:36382796-36382818 TCTATATTTTGACTTGCTCCAGG + Intronic
1157019054 18:43757091-43757113 TGTATATTCTTCTTTGCTGCTGG - Intergenic
1157112872 18:44837505-44837527 CATATATTCTTAGTTTCTGCGGG - Intronic
1157181315 18:45500730-45500752 TTTATATTCTGAGTCTTGGCTGG - Intronic
1158650731 18:59282729-59282751 GTCACATTCTGAGGTGCTGCGGG - Intronic
1159872946 18:73778937-73778959 TTGATGGTCTGGGTTGCTGCAGG - Intergenic
1161422069 19:4181405-4181427 TTTTTAATCTGTGTTGCTCCTGG + Intronic
1162216912 19:9142508-9142530 TTTTTCTTGTGAATTGCTGCAGG + Intronic
1168555233 19:57333303-57333325 TTTCCCTTCTGAGTTGCTGAGGG + Intergenic
926034786 2:9627777-9627799 TTCATGTGCAGAGTTGCTGCAGG - Intronic
927020307 2:19009916-19009938 TCTATTTACTGAGTTTCTGCAGG - Intergenic
927805680 2:26144526-26144548 TTTATATTTTTAGTAGATGCAGG - Intergenic
928158876 2:28902800-28902822 TTTATATTCTGCTGTGATGCTGG - Intronic
929313279 2:40450296-40450318 TTTTTTTTCTGACTCGCTGCAGG + Intronic
929825743 2:45308367-45308389 TTAATATTTTGAGTTGTTCCTGG - Intergenic
930470950 2:51812412-51812434 TTTATCTTTTGATTTGCTCCAGG - Intergenic
931143968 2:59496094-59496116 TTCACATTTTGAGATGCTGCTGG + Intergenic
931273970 2:60727566-60727588 TTTATATTCTCACTTTCAGCTGG - Intergenic
931534035 2:63252059-63252081 TTAACTTTCTGATTTGCTGCTGG - Intronic
931587354 2:63842221-63842243 CTTATATCCCGAGTTGCTTCAGG + Intronic
931588642 2:63856483-63856505 TCTTCATGCTGAGTTGCTGCCGG + Intronic
935963180 2:108447491-108447513 TTTATTTTCTGAGATGATGGAGG - Intergenic
937206771 2:120241552-120241574 TTTATATTTTTAGTAGCAGCGGG - Intronic
939231224 2:139428485-139428507 TTACTATGCTGATTTGCTGCTGG - Intergenic
939507396 2:143063877-143063899 TTTTTATTCTGAGTATCTGAGGG + Intergenic
939962618 2:148578812-148578834 ATTATATTCTGAGATACTGAGGG - Intergenic
940218433 2:151325089-151325111 TTTATTATCTCAGTTTCTGCGGG + Intergenic
940245420 2:151610323-151610345 ATTATAGTTAGAGTTGCTGCAGG - Intronic
940719288 2:157263760-157263782 TTTATAAACAGACTTGCTGCAGG - Intronic
942062537 2:172240965-172240987 TTTGTATTCTCAGTTGCTTGCGG + Intergenic
942143082 2:172997416-172997438 ATTATATTCTGAGATACTGGAGG + Intronic
942729475 2:179048306-179048328 TTTATACTCTGAATTGCTTGGGG + Intronic
943714539 2:191135991-191136013 TTTTTTTTCTGAGATGCTGTTGG - Intronic
945750355 2:213774559-213774581 TTCATATTCTGAGTTAATGGGGG + Intronic
947021190 2:225677782-225677804 TTAATTTTTTGAGGTGCTGCTGG + Intergenic
1170554899 20:17506992-17507014 TTTCTGTCCTGAGTGGCTGCAGG - Intronic
1170998945 20:21395169-21395191 TTTATTTTCTCAGTTGATGTTGG + Intergenic
1172376292 20:34443680-34443702 TTTACGTTGTTAGTTGCTGCCGG + Intronic
1172585954 20:36084771-36084793 TTAATATTCTGAGGTTCTGAGGG + Intergenic
1174403247 20:50287607-50287629 TTTATTTTCTGAGCTGTGGCCGG + Intergenic
1174909249 20:54588631-54588653 TTTAGATTCTGAATGGATGCTGG + Intronic
1175382518 20:58573597-58573619 TTCATTTTCTGAGTTGATCCAGG - Intergenic
1176267381 20:64217306-64217328 TTTCTCTTCTGTGTTGCTCCTGG + Intronic
1177654344 21:23998498-23998520 TATATAATCTGTGTTGCTGGAGG + Intergenic
1177685141 21:24426442-24426464 TTTACTTTCTGAGTTTCTGGAGG - Intergenic
1178077351 21:29024268-29024290 TTTTTATTCTGACATGGTGCAGG + Intergenic
1178670164 21:34583023-34583045 GTTATATTCAGAGTGTCTGCAGG - Intronic
1179500011 21:41802676-41802698 TTTATGTTCTGATTAGGTGCCGG - Intronic
1180031569 21:45212365-45212387 TGCATGTTCTGAGTTCCTGCAGG - Intronic
1182612638 22:31561705-31561727 ATTATTTTCTGATTTGCTGTAGG - Intronic
1182913995 22:34011039-34011061 TTTGTATTTTTAGTTGATGCAGG + Intergenic
1184824263 22:46936421-46936443 TGTATATTCTGAGTTGCTTCTGG - Intronic
1184854983 22:47141875-47141897 ATAATATTCTGAGTTGTGGCTGG + Intronic
949097229 3:99834-99856 TTTATTTTCCCAGTGGCTGCAGG - Intergenic
950607886 3:14100081-14100103 TTTATATTCTTAGCTTCTGTAGG + Intergenic
951231031 3:20179994-20180016 TCTAGATTCAGAGTGGCTGCAGG + Intronic
951873042 3:27387687-27387709 TTCATATTCTGAGGTACTGGAGG - Intronic
952506589 3:34012215-34012237 TTTAAATCCTGAGCTGCTGAAGG + Intergenic
952587523 3:34910729-34910751 TTTATATTCTCTTTTTCTGCAGG + Intergenic
953211966 3:40884199-40884221 GATATATTCTGGGATGCTGCTGG - Intergenic
953988053 3:47460850-47460872 TTTATATTAAGAGTTCTTGCTGG - Intronic
957054363 3:75432822-75432844 ATCAGATTCTGAGCTGCTGCGGG - Intergenic
957231962 3:77531007-77531029 ATCATGTTTTGAGTTGCTGCTGG - Intronic
957236640 3:77601476-77601498 TTGATATTCAGTGTTGCTCCTGG + Intronic
957538164 3:81532661-81532683 ATTTTATAGTGAGTTGCTGCAGG - Intronic
959164578 3:102760014-102760036 TGTAGATTTTGAGTTGATGCTGG + Intergenic
960300795 3:116000180-116000202 TTGCTATTCTCAGTTGGTGCAGG - Intronic
960331857 3:116369711-116369733 TTTATATTCTGAGCTGGGGGAGG - Intronic
960424394 3:117488323-117488345 GTTATATTCTGAGGTACTGGAGG - Intergenic
961888027 3:130109187-130109209 ATCAGATTCTGAGCTGCTGCGGG - Intronic
963403651 3:144835127-144835149 TTTATATTCTATGTAGCTACTGG + Intergenic
963478061 3:145831939-145831961 TTTATATTTTTAGTTGAGGCAGG - Intergenic
963658083 3:148085121-148085143 TTTTAATTCTGACTTGCTTCTGG + Intergenic
964580851 3:158235942-158235964 TTTATATTTTTAGTAGATGCAGG - Intronic
964624431 3:158745829-158745851 GTAATATTCTGAGGTGCTGGGGG + Intronic
964891497 3:161541447-161541469 TTTATATTCTCATTTTCTACTGG - Intergenic
965928265 3:174009727-174009749 TTTATAATCTGAGTTTCCACAGG + Intronic
966784949 3:183615037-183615059 TGTATATTCTGAGTCTCTCCAGG + Intergenic
966795710 3:183711542-183711564 TTTATATTCTGAATTGTAGCAGG + Intronic
969756841 4:9155550-9155572 ATCAGATTCTGAGCTGCTGCGGG + Intergenic
972851304 4:43053866-43053888 TTTAAATTTTGAGTTGATGCTGG + Intergenic
972994807 4:44867220-44867242 ATTACATTTTGAGGTGCTGCTGG + Intergenic
973048449 4:45566120-45566142 TATATATTCTGAGTTGTTTAGGG + Intergenic
973563273 4:52158210-52158232 TTTCTCTTCTGACTAGCTGCTGG + Intergenic
974496711 4:62638614-62638636 TTTGTAATCTGAGTTTCTGTAGG - Intergenic
974534217 4:63154014-63154036 TTTATTTGCTGAGTTGATTCAGG + Intergenic
975400176 4:73928043-73928065 TTTGTATCCTGAGATGTTGCAGG - Intergenic
976570277 4:86599088-86599110 TTAATAGTCTGAGTTGAGGCCGG - Intronic
977060888 4:92255843-92255865 TTTATATTGTGATCTGTTGCTGG + Intergenic
977544732 4:98364045-98364067 TTTTTATTTTGTTTTGCTGCAGG + Intronic
978555264 4:109973020-109973042 TATATATTCTGGTTTGCAGCAGG + Intronic
980247930 4:130271415-130271437 TTTGAATTCTGAGATACTGCTGG + Intergenic
980693955 4:136331629-136331651 TTAATTTTCTGATGTGCTGCTGG - Intergenic
980757811 4:137189204-137189226 GTTACATTCTGAGTTACTGAGGG + Intergenic
981796956 4:148606206-148606228 TTGAACTTCTGAGTTGATGCTGG + Intergenic
984962750 4:185113455-185113477 GTTACATTCTGAGGTGCTGGGGG - Intergenic
986249476 5:6043512-6043534 TTTATTTTCTGTATTCCTGCGGG + Intergenic
988026785 5:25704540-25704562 TCTATATTCTGTGTTGCTGGTGG + Intergenic
989408201 5:41085850-41085872 TTTATATTTTTAGTAGCGGCGGG + Intergenic
989419097 5:41214994-41215016 TCTAGATTCTTAGTTGGTGCTGG - Intronic
990439543 5:55831137-55831159 TTTATATTCTTAGTGTCTTCAGG + Intergenic
991045401 5:62217845-62217867 TGTATAGACTGAGATGCTGCTGG - Intergenic
992778596 5:80108752-80108774 GTCAGATTCTGAGTTGCTGGGGG - Intergenic
993176720 5:84495966-84495988 TTTATTTTCTGTGCTGCTTCAGG + Intergenic
993897527 5:93555331-93555353 TTTAAAGAATGAGTTGCTGCTGG + Intergenic
994520439 5:100827648-100827670 TTTACATTCTGAATGGCAGCTGG + Intronic
994645681 5:102465967-102465989 TGAATATTCTGAGTTTCTGGTGG - Intronic
995919279 5:117291804-117291826 TTTACATTCTGAGTTGTTGCTGG - Intergenic
997099124 5:130948541-130948563 TTAATTTTTTGATTTGCTGCAGG - Intergenic
999114572 5:149151355-149151377 GTTATATTCTGAGGTACTGAGGG + Intronic
999666404 5:153917375-153917397 TTTATCTTGTGAGGTGCTGGTGG + Intergenic
999886628 5:155931263-155931285 TTTATATTCTGAGTTCCATTGGG + Intronic
1000359650 5:160435081-160435103 GTCATATTCTGAGGTGCTGGGGG + Intergenic
1000880187 5:166688311-166688333 TTTATATTCTGAGGTATTGGGGG + Intergenic
1001770130 5:174289071-174289093 ATTACATTCTGAGGTGCTGAGGG - Intergenic
1004593993 6:17081432-17081454 TTTGTCTTCTGAGTCACTGCAGG + Intergenic
1004651646 6:17615632-17615654 TTTCTATGCTGAGTTTGTGCTGG - Exonic
1007497903 6:42273981-42274003 TTTGCATTCTGAGTTGCAGGAGG + Intronic
1007805951 6:44446660-44446682 TAGATATGCTGATTTGCTGCTGG + Exonic
1008053920 6:46927256-46927278 TTTTTATTCTGATTTTCTCCTGG - Intronic
1008910742 6:56729771-56729793 TTTATTTTCTGATTTGGTGGCGG - Intronic
1008947205 6:57111340-57111362 TTCATATTCAGAGTTACTGTGGG + Intronic
1009446648 6:63750378-63750400 TTTATATTCTGACTTTGTACAGG + Intronic
1010115108 6:72296601-72296623 TTTCTGTTCAGAGTTGCTGTTGG + Intronic
1010565089 6:77400961-77400983 TTTATATTCTTAGTAGAGGCGGG - Intergenic
1010738494 6:79469946-79469968 TTTATTGTCTGAGTTGTAGCTGG + Intergenic
1011738504 6:90336001-90336023 TTTAGTTGCTGAGTTGATGCTGG - Intergenic
1012177582 6:96107733-96107755 TCTACATGCTGAGTTGCTGGAGG - Intronic
1012213389 6:96552227-96552249 TTTTTGTTTTGAGTTGCTGGAGG - Intronic
1012546079 6:100420943-100420965 TTTGTATTCTGTGTCTCTGCAGG + Exonic
1013645031 6:112128923-112128945 TTTTTATTCTGACTTGCTTTAGG + Exonic
1013674933 6:112448670-112448692 TTTACTTTCTGAGTTTGTGCAGG + Intergenic
1013940169 6:115651520-115651542 GTCATATTCTGAGTTACTGGGGG + Intergenic
1015503630 6:133959209-133959231 TTTATATTTTTAGTAGATGCAGG + Intronic
1017483092 6:154877335-154877357 TTTATATTTTGAGTTTCTATTGG - Intronic
1018768592 6:166953387-166953409 CTTATATCCTGTGTTGCTGCTGG - Intronic
1020159741 7:5760654-5760676 TTTATGTTCTGAAATACTGCAGG - Intronic
1020354363 7:7260590-7260612 TCTATACACTGAGTTCCTGCGGG - Intergenic
1020751767 7:12149422-12149444 ATCATATTCTGAGGTGCTGCAGG - Intergenic
1021081606 7:16371250-16371272 TTTATTTACTGAGTTGATTCAGG - Intronic
1021852243 7:24819758-24819780 TTTATATTTTGAGTTGGGGTTGG - Intronic
1022971211 7:35519076-35519098 TTTATTTTCTGAGCTGCTTCTGG + Intergenic
1023142363 7:37114114-37114136 TTTTTACTCTGAGTTACTGGAGG + Intronic
1023902094 7:44489775-44489797 TTTACACTCTTAGTTGCCGCAGG - Intronic
1023923383 7:44647100-44647122 TTTATGTTCTGAGCTGAGGCAGG + Intronic
1024208151 7:47181468-47181490 TTTATCTTCTGAGATGAAGCTGG + Intergenic
1025157267 7:56619253-56619275 TTTTTTTCCTGAGTTGCTTCAGG + Intergenic
1027570642 7:79861584-79861606 TTTATATTTTGAGGTGCAGTTGG - Intergenic
1027772947 7:82430242-82430264 TTTATATTCTGAGTAGAGACGGG - Intronic
1028134632 7:87212374-87212396 CATATTTTCTGAGTTGCTGAAGG - Intronic
1029379564 7:100204179-100204201 CTTACATTCTGAGTGGCTGAGGG - Intronic
1029629702 7:101742741-101742763 TTTACATTCTAGGGTGCTGCGGG - Intergenic
1030589293 7:111461083-111461105 TTTATATTTTGACTTAGTGCTGG + Intronic
1036380074 8:8230869-8230891 ATCAGATTCTGAGCTGCTGCAGG + Intergenic
1036476067 8:9094672-9094694 TTTACAATGTGAGTTCCTGCTGG + Intronic
1036758783 8:11492246-11492268 TTTTCTTTCTGAGTGGCTGCTGG + Intergenic
1036849483 8:12191793-12191815 ATCAGATTCTGAGCTGCTGCGGG - Exonic
1036870845 8:12434066-12434088 ATCAGATTCTGAGCTGCTGCGGG - Exonic
1037712707 8:21368142-21368164 TTTATATTCTAATTCTCTGCTGG + Intergenic
1038362074 8:26890265-26890287 TTTATAGTCAGAGTTGCTGAAGG - Intergenic
1038670210 8:29577056-29577078 TTTAGCTTCTGATTTGCTGTTGG + Intergenic
1039008292 8:33065342-33065364 TTCAAATTCTGAGCTGCTTCTGG + Intergenic
1041435325 8:57832608-57832630 GTCATATTTTGAGTTGCTGGGGG + Intergenic
1042034681 8:64519041-64519063 TCTGTCTTCTGAGTTACTGCAGG + Intergenic
1042081328 8:65056119-65056141 TTTATATTTTTAGTTGCTAATGG + Intergenic
1043283037 8:78493193-78493215 TTTATATTCTGATTTCATGTAGG + Intergenic
1043631111 8:82335203-82335225 TTTAGATTTTGTGTTCCTGCTGG - Intergenic
1044174316 8:89099043-89099065 TTTATATTCTTAGTAACTACTGG - Intergenic
1044204607 8:89477905-89477927 TTTGTCTTCTGAGTTTCTTCAGG - Intergenic
1044585734 8:93867907-93867929 TTCATATTCTGAGGTACTGGGGG - Intronic
1045271747 8:100668065-100668087 TTGATATTCTAATTTGCTGATGG + Intergenic
1045579788 8:103466266-103466288 TTTATATTCTGAGTAGAGACGGG + Intergenic
1046676644 8:117115980-117116002 TTTATATTATGAGTGGCTTAAGG + Intronic
1048408741 8:134150106-134150128 TTCATATTCTGAGTACTTGCAGG - Intergenic
1048648235 8:136446044-136446066 TTTCTATTCGGAGTTCCTGGGGG + Intergenic
1048954217 8:139521442-139521464 TGTGTATGCTGAGTTGCTTCTGG + Intergenic
1049005252 8:139851355-139851377 TCTATCTTTTGAGTTGCTGTGGG - Intronic
1050717210 9:8543647-8543669 TTTATCTTCTGAGTTAATTCCGG - Intronic
1052455205 9:28688124-28688146 TTCACATACAGAGTTGCTGCAGG + Intergenic
1052608327 9:30733723-30733745 TATATATTTGGAGTTGCTGAGGG + Intergenic
1055990221 9:82097858-82097880 TTAATTTTTTGATTTGCTGCTGG + Intergenic
1059259256 9:112960116-112960138 GTTAAAGTCTGAGTGGCTGCTGG - Intergenic
1059785576 9:117579093-117579115 TTGAAATTTTGAGTTGTTGCTGG + Intergenic
1060004227 9:119985509-119985531 TTTATATGCTGTGTTGGTGTTGG - Intergenic
1061279733 9:129590652-129590674 GTTTTATTCTGAGTTGGTGGGGG + Intergenic
1185942536 X:4337783-4337805 TATATCGTCTGAGTTCCTGCAGG - Intergenic
1186740378 X:12511142-12511164 TTTATAGTCTGACTTTGTGCAGG - Intronic
1186794315 X:13029672-13029694 TTTATTTTTACAGTTGCTGCTGG - Intergenic
1187193872 X:17062475-17062497 TTCTTATTCTGAGTCACTGCCGG + Exonic
1191015356 X:55804159-55804181 TTTACATTCTCAGTTGGAGCGGG + Intergenic
1193363289 X:80600560-80600582 TTTATTTTCTAAGTTGATGATGG + Intergenic
1194739280 X:97553039-97553061 GTTATATTCTGAGGTACTGCAGG + Intronic
1195119585 X:101736831-101736853 TTTATATTATGAGTCACAGCAGG + Intergenic
1197275188 X:124469994-124470016 TTTATATTGAGAGCTGCTGAGGG + Intronic
1197367194 X:125578733-125578755 TTTAGATTTTAAGTTGATGCTGG - Intergenic
1197383218 X:125770827-125770849 TATACATTCTGAGTTCCTTCTGG - Intergenic
1198702755 X:139415356-139415378 TTTATTTTCTTCGTGGCTGCAGG - Intergenic
1199419823 X:147631956-147631978 GTCATATTCTGAGTTGCTGGGGG + Intergenic
1199857393 X:151771508-151771530 TTTCTCTTCTGAGTTTCTTCAGG - Intergenic
1201794091 Y:17875813-17875835 TTTTTAATCTGAGTAGCTGTGGG + Intergenic
1201807463 Y:18030172-18030194 TTTTTAATCTGAGTAGCTGTGGG - Intergenic