ID: 924252483

View in Genome Browser
Species Human (GRCh38)
Location 1:242146797-242146819
Sequence GCCACCTTTTGTCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924252483 Original CRISPR GCCACCTTTTGTCCTGTTAC TGG Intronic
900016416 1:153410-153432 GCCACCTTATTTTCTATTACTGG - Intergenic
900046678 1:512002-512024 GCCACCTTATTTTCTATTACTGG - Intergenic
900068883 1:753719-753741 GCCACCTTATTTTCTATTACTGG - Intergenic
901904048 1:12392648-12392670 GACAGCTCTTGGCCTGTTACTGG - Intronic
906050491 1:42867450-42867472 GACAGCTCTTGGCCTGTTACTGG + Intergenic
906709044 1:47915770-47915792 GCCACCTCATGCCCTGTGACAGG - Intronic
907780344 1:57560870-57560892 GTCAGCTCTTGGCCTGTTACTGG + Intronic
909576923 1:77185894-77185916 GACAGCTCTTGGCCTGTTACTGG + Intronic
909810956 1:79931373-79931395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910370637 1:86512164-86512186 GACAGCTCTTGGCCTGTTACTGG + Intergenic
910588218 1:88901762-88901784 GACAGCTCTTGTCTTGTTACTGG + Intergenic
910630224 1:89346288-89346310 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
910638988 1:89439938-89439960 GACAACTCTTGGCCTGTTACTGG - Intergenic
910790324 1:91043756-91043778 GACAGCTGTTGGCCTGTTACTGG + Intergenic
910948217 1:92616724-92616746 GACAGCTGTTGGCCTGTTACTGG + Intronic
911109095 1:94164169-94164191 GACAACTCTTGGCCTGTTACTGG - Intronic
911257322 1:95647328-95647350 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
912067025 1:105756983-105757005 GACAGCTCTTGGCCTGTTACTGG + Intergenic
912129909 1:106588014-106588036 GACAACTCTTGGCCTGTTACTGG - Intergenic
912733320 1:112128793-112128815 GACAGCTCTTGGCCTGTTACTGG - Intergenic
912943810 1:114068168-114068190 GACAGCTTTTAGCCTGTTACTGG - Intergenic
913039444 1:115008359-115008381 GACAGCTCTTGTCCTGTTACTGG - Intergenic
916106327 1:161435291-161435313 GACAGCTCTTGGCCTGTTACTGG - Intergenic
916285319 1:163099564-163099586 GACAGCTCTTGGCCTGTTACTGG + Intergenic
917462710 1:175246219-175246241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
918648932 1:186935630-186935652 GCCACCTTTTCTTCTGGTAAGGG - Intronic
918958248 1:191237985-191238007 GACAGCTCTTGGCCTGTTACTGG + Intergenic
919317976 1:195999398-195999420 GATAGCTTTTGGCCTGTTACTGG + Intergenic
920197433 1:204238402-204238424 GACACCTGTTGGTCTGTTACTGG + Intronic
920866176 1:209755961-209755983 GCCACCCTTTCTCTTGCTACTGG - Intergenic
922104238 1:222499109-222499131 GCCACCTTATTTTCTATTACTGG - Intergenic
922709903 1:227819380-227819402 GTCTCCTTTGGTCATGTTACAGG + Intronic
923253567 1:232199401-232199423 GACAGCTCTTGGCCTGTTACTGG - Intergenic
924252483 1:242146797-242146819 GCCACCTTTTGTCCTGTTACTGG + Intronic
924840774 1:247707796-247707818 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1063692652 10:8302027-8302049 GCCTCCTCTTGTTCTGTGACTGG + Intergenic
1065005328 10:21374200-21374222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1066167025 10:32799194-32799216 GTCAGCTCTTGGCCTGTTACTGG - Intronic
1066169429 10:32826354-32826376 GACACCTCTTGTCCTATTACTGG + Intronic
1067024711 10:42834578-42834600 TCAACCTTTTGTCTTGTTAAAGG - Exonic
1068447212 10:57138629-57138651 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1068541039 10:58295189-58295211 GCCTCCTTGGGTCCTGTTTCGGG - Intergenic
1068837214 10:61568342-61568364 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1068925232 10:62528972-62528994 GCCATCATTAGTTCTGTTACAGG - Intronic
1069145765 10:64890476-64890498 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1071673925 10:87637393-87637415 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1073918474 10:108432279-108432301 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1073957680 10:108891617-108891639 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1074701784 10:116098653-116098675 GCGACCTTTTGTCTTGTCTCTGG - Intronic
1075400321 10:122156597-122156619 GCCACCTTCTGTCCTCATCCTGG + Intronic
1076224358 10:128762176-128762198 GCCACCTTTTGACCTGCTCTGGG + Intergenic
1076772627 10:132674803-132674825 GACAGCTCTTGGCCTGTTACTGG - Intronic
1076973007 11:148479-148501 GCCACCTTATTTTCTATTACTGG - Intergenic
1079514166 11:21247521-21247543 TCCAACTTTTGTCCCGTTAGAGG + Intronic
1080076595 11:28157531-28157553 GACAGCTCTTGGCCTGTTACTGG + Intronic
1080976682 11:37350608-37350630 GACAGCTTTTGGCTTGTTACTGG + Intergenic
1081110479 11:39128429-39128451 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1081609063 11:44547888-44547910 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085685964 11:78622200-78622222 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1085747572 11:79128250-79128272 GACAGCTCTTGGCCTGTTACTGG + Intronic
1086834117 11:91600403-91600425 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1087476292 11:98639216-98639238 GCCAAATTTTGTCTTCTTACAGG + Intergenic
1088097206 11:106115168-106115190 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1088407610 11:109498652-109498674 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1089903607 11:122013619-122013641 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1090209491 11:124908040-124908062 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1092093285 12:5821661-5821683 GACAGCTCTTGGCCTGTTACAGG + Intronic
1093031869 12:14295939-14295961 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1093036338 12:14335694-14335716 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1095856239 12:46863664-46863686 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097077001 12:56402452-56402474 GACAGCTCTTGACCTGTTACTGG + Intergenic
1097437837 12:59572243-59572265 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1097564647 12:61252418-61252440 GACAGCTCTTGACCTGTTACTGG - Intergenic
1097821340 12:64131853-64131875 GACAGCTCTTGGCCTGTTACTGG - Intronic
1098673042 12:73254255-73254277 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1098731052 12:74037359-74037381 GACAGCTGTTGGCCTGTTACTGG + Intergenic
1098914852 12:76246664-76246686 TCCTCCTTTTTTCCTCTTACTGG - Intergenic
1098933759 12:76452809-76452831 GCCATCTTTTGCCCAGTCACAGG + Intronic
1099365925 12:81765395-81765417 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1099379381 12:81936529-81936551 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1099578077 12:84405402-84405424 GGCAGCTTTTGGCCTGTTACTGG + Intergenic
1100049424 12:90428610-90428632 GGCTCCTTTCCTCCTGTTACAGG + Intergenic
1100241151 12:92711597-92711619 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1100990850 12:100250011-100250033 GCCACGCTTTTTCCTGTTACGGG - Intronic
1101534667 12:105606093-105606115 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1101543072 12:105682647-105682669 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1101625224 12:106434144-106434166 GCCACCATTTGTCATTTTAATGG + Intronic
1103396528 12:120611458-120611480 GACAGCTCTTGACCTGTTACTGG + Intergenic
1105740110 13:23315187-23315209 GACAACTCTTGGCCTGTTACTGG + Intronic
1109583049 13:64366178-64366200 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1109712680 13:66180811-66180833 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1109951023 13:69502194-69502216 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1110192704 13:72749727-72749749 GCCACGTTTTCTCTTGTTACAGG + Intronic
1110377173 13:74806480-74806502 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1110834134 13:80064618-80064640 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1111057798 13:82973016-82973038 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1114205871 14:20570780-20570802 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1116158377 14:41236654-41236676 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1117216844 14:53560186-53560208 GACACCTCTTGGCCTGTTACTGG + Intergenic
1117634134 14:57724384-57724406 GACAGCTGTTGGCCTGTTACTGG + Intronic
1118601106 14:67472020-67472042 GCCCCACTTTGTCCTGTGACAGG - Exonic
1118880773 14:69824007-69824029 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1120169407 14:81233997-81234019 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1120231422 14:81845240-81845262 GACAGCTGTTGGCCTGTTACTGG - Intergenic
1121764439 14:96473728-96473750 GCTACCTTTTGCTTTGTTACAGG - Intronic
1122375562 14:101254711-101254733 GACACCATTTGGCCTGTAACAGG + Intergenic
1126146749 15:45481419-45481441 GCAACCTTTTGGTCTGTTTCAGG - Exonic
1128830731 15:70765993-70766015 GCCTCCTTTTCTGTTGTTACTGG + Intergenic
1130445924 15:84001811-84001833 GCCAACCTTTGGCCTGATACTGG - Intronic
1131724011 15:95202806-95202828 GACAGCTCTTGGCCTGTTACCGG + Intergenic
1135670388 16:24370498-24370520 GCCACTTTTTTTCTGGTTACTGG - Intergenic
1141559542 16:84858027-84858049 GACAGCTCTTGGCCTGTTACTGG - Intronic
1142447245 16:90149047-90149069 GCCACCTTATTTTCTATTACTGG + Intergenic
1142460248 17:86284-86306 GCCACCTTATTTTCTATTACTGG - Intergenic
1144326976 17:14192011-14192033 GCCACTTGTTGTGCTGTTCCGGG + Exonic
1144475863 17:15588874-15588896 GCCACTTGTTGTGCTGTTCCAGG + Exonic
1146836356 17:36114011-36114033 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153089710 18:1330169-1330191 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1153162001 18:2216907-2216929 CCCACCTTCTGCCCTGTGACAGG - Intergenic
1153217693 18:2835595-2835617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1154506173 18:15042897-15042919 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1154962163 18:21320255-21320277 GCAACCTTTTTTCTTGTTAGTGG - Intronic
1155157295 18:23168353-23168375 CACACTGTTTGTCCTGTTACTGG - Intronic
1156072723 18:33232251-33232273 GCTATCTTTTGTCCTAGTACAGG - Intronic
1156303861 18:35858701-35858723 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1157265138 18:46212564-46212586 GCTAACTTTTGTCCTGTTTGTGG + Intronic
1157341203 18:46780034-46780056 GACAACTCTTGGCCTGTTACTGG + Intergenic
1157998504 18:52588117-52588139 GACAGCTCTTGGCCTGTTACTGG - Intronic
1159287789 18:66375489-66375511 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1160092464 18:75840022-75840044 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1160649963 19:218784-218806 GCCACCTTATTTTCTATTACTGG - Intergenic
1160780089 19:873680-873702 GTCCCCTTGTGTCCTGGTACTGG - Intronic
1164117257 19:22234567-22234589 GACAACTCTTGGCCTGTTACTGG - Intergenic
1164702311 19:30294648-30294670 GCCACCCACTGTCTTGTTACTGG - Intronic
1165612038 19:37163501-37163523 GCCACCTTTTGTGTTTTTGCAGG - Intronic
925843831 2:8018072-8018094 GCCACATTTTGTCTTATTTCTGG - Intergenic
926810395 2:16750669-16750691 GACAGCTCTTGGCCTGTTACTGG - Intergenic
927008718 2:18879731-18879753 GACAGCTCTTGGCCTGTTACTGG + Intergenic
927085354 2:19669773-19669795 GCCACATGTTGGCCTGTTATGGG + Intergenic
928187670 2:29127296-29127318 GCCCAATTGTGTCCTGTTACAGG + Intronic
928275444 2:29896326-29896348 GGCAGATTTTGTGCTGTTACGGG + Intronic
928501471 2:31901024-31901046 ACCACATTTTGTCCATTTACCGG - Intronic
928855247 2:35795596-35795618 TCCACCTTTTGTCCTGTTCCTGG - Intergenic
930376769 2:50577233-50577255 TTCATTTTTTGTCCTGTTACTGG + Intronic
930418605 2:51121002-51121024 GACATCTTTTGGCCTGTTACTGG + Intergenic
930879121 2:56251850-56251872 GCCACCTTCTCTCCTGCTACGGG - Intronic
932877793 2:75471781-75471803 GCCAGCTTTTGTCTTTTTCCAGG + Intronic
933265684 2:80178373-80178395 GACAGCTCTTGGCCTGTTACTGG - Intronic
933394462 2:81713348-81713370 GACAGCTCTTGGCCTGTTACTGG - Intergenic
935183936 2:100714908-100714930 GACAGCTCTTGGCCTGTTACTGG + Intergenic
935564308 2:104590244-104590266 GACAGCTCTTGGCCTGTTACTGG - Intergenic
936641226 2:114314699-114314721 GACAGCTCTTGGCCTGTTACTGG + Intergenic
937785205 2:125887719-125887741 GACAGCTCTTGGCCTGTTACTGG - Intergenic
939069063 2:137517865-137517887 GGCAGCTCTTGGCCTGTTACTGG + Intronic
939788685 2:146546104-146546126 GACAACTCTTGGCCTGTTACTGG - Intergenic
942492588 2:176504884-176504906 CCAACCTTTTGTCCTGTTTGAGG - Intergenic
943239218 2:185362563-185362585 GACAACTCTTGGCCTGTTACTGG - Intergenic
943388130 2:187227145-187227167 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
943517597 2:188907233-188907255 GACATCTCTTGGCCTGTTACTGG - Intergenic
945717834 2:213380660-213380682 GACAGCTCTTGGCCTGTTACTGG - Intronic
946790922 2:223299769-223299791 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1175888427 20:62305116-62305138 GCCGTTTTTTGTGCTGTTACAGG + Intronic
1176791680 21:13326127-13326149 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1176978747 21:15354595-15354617 TCCCTCTTTTGTCCAGTTACTGG + Intergenic
1176998161 21:15580193-15580215 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177139415 21:17342260-17342282 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177233420 21:18352938-18352960 AGCACCTTTTCTCCTTTTACTGG - Exonic
1177505560 21:22014173-22014195 GACAGCTTTTGGCCTGCTACTGG - Intergenic
1177913176 21:27056219-27056241 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1177933697 21:27316923-27316945 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1177991071 21:28037129-28037151 GACAGCTTGTGGCCTGTTACTGG - Intergenic
1179052208 21:37897527-37897549 GCCACCTATGGTCCTGATCCTGG + Intronic
1180136076 21:45862883-45862905 GTCACCCTCTGTTCTGTTACAGG - Intronic
1180591146 22:16938358-16938380 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1181420654 22:22795840-22795862 GACAGCTGTTGGCCTGTTACTGG + Intronic
1182883059 22:33750064-33750086 TCCACCTTTTGGCCTGGTGCTGG - Intronic
1183679044 22:39316392-39316414 GCCTCTTGCTGTCCTGTTACTGG - Intronic
1184076458 22:42182120-42182142 GCCACCTCTAGCCTTGTTACAGG + Intronic
1184223214 22:43113956-43113978 GCCTCCCTTTGTCCTGCCACTGG + Intronic
1184603560 22:45558366-45558388 GACAGCTCTTGGCCTGTTACTGG - Intronic
949170039 3:986595-986617 GACAGCTCTTGGCCTGTTACTGG - Intergenic
949445612 3:4131062-4131084 GACAGCTCTTGGCCTGTTACTGG + Intronic
951384526 3:22027543-22027565 GACAGCTCTTGGCCTGTTACTGG + Intronic
951508383 3:23474752-23474774 GACACCTTTTCTGCTGTGACAGG - Intronic
953025523 3:39142764-39142786 GCCACATTTTCTCCTCTTCCAGG + Exonic
954054157 3:48007968-48007990 GTCAGCTCTTGGCCTGTTACTGG + Intronic
954246277 3:49334358-49334380 GCCACCATTTGACCTATTTCAGG + Intronic
954511490 3:51129653-51129675 GGCAGCTCTTGGCCTGTTACTGG - Intronic
957754598 3:84469434-84469456 GACAGCTCTTGGCCTGTTACTGG + Intergenic
958487677 3:94732466-94732488 GACAGCTCTTGGCCTGTTACTGG - Intergenic
959226778 3:103597268-103597290 GACAGCTTTTGGCCTGTTACTGG - Intergenic
959746013 3:109777265-109777287 GACAGCTTTTGGACTGTTACTGG - Intergenic
963087225 3:141449294-141449316 GCCTCCTTTAATCCTGTTCCAGG - Exonic
963453671 3:145516675-145516697 GACAGCTCTTGGCCTGTTACTGG + Intergenic
963661393 3:148132153-148132175 GACACCTCTTGACCTGTTACTGG + Intergenic
966044329 3:175530913-175530935 GACAGCTCTTGGCCTGTTACTGG - Intronic
967831777 3:193925998-193926020 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968070204 3:195779950-195779972 GCCACCCCTCTTCCTGTTACCGG - Exonic
968367883 3:198201345-198201367 GCCACCTTATTTTCTATTACTGG + Intergenic
968686204 4:1960586-1960608 GCAACCTTTTGTGCTGTTGCTGG - Intronic
968800184 4:2738129-2738151 GACAGCTCTTGGCCTGTTACTGG + Intergenic
968906947 4:3457975-3457997 GACAGCTCTTGGCCTGTTACTGG + Intergenic
970773903 4:19649488-19649510 GCCCCCTTTTTCCCTTTTACTGG + Intergenic
973118443 4:46489051-46489073 GGCAGCTCTTGGCCTGTTACTGG + Intergenic
974244677 4:59299577-59299599 CCCACCTACTTTCCTGTTACTGG - Intergenic
974262370 4:59542261-59542283 GACAGCTCTTGGCCTGTTACTGG - Intergenic
974644615 4:64674756-64674778 GACAGCTCTTGGCCTGTTACTGG - Intergenic
975386716 4:73767501-73767523 GACAGCTTTTGGCCTGTTACTGG - Intergenic
975841379 4:78477916-78477938 GCCAGCTTATGCCCTGTTAGGGG + Intronic
975982614 4:80177269-80177291 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977204717 4:94155692-94155714 GACAGCTCTTGGCCTGTTACTGG + Intergenic
977430767 4:96928220-96928242 GACAGCTTTTGGCCTCTTACTGG + Intergenic
977490070 4:97700063-97700085 GACAGCTCTTGGCCTGTTACTGG - Intronic
977701730 4:100029879-100029901 GACAGCTCTTGGCCTGTTACTGG - Intergenic
977833274 4:101618160-101618182 GACAGCTCTTGGCCTGTTACTGG - Intronic
977930411 4:102743811-102743833 GACAGCTCTTGGCCTGTTACTGG - Intronic
978341589 4:107725541-107725563 GACAGCTTGTGGCCTGTTACTGG - Intergenic
978772151 4:112467772-112467794 GACAGCTTTTGGCCTGTTACTGG - Intergenic
978899074 4:113926810-113926832 GACAGCTCTTGGCCTGTTACTGG - Intronic
979256311 4:118611060-118611082 GCCACCTTATTTTCTATTACTGG + Intergenic
979332039 4:119429476-119429498 GCCACCTTATTTTCTGTTACTGG - Intergenic
979767021 4:124474603-124474625 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980405890 4:132353783-132353805 GACAGCTTTTGGCCTGTTACTGG - Intergenic
980629523 4:135414294-135414316 GACAGCTCTTGGCCTGTTACTGG + Intergenic
980957732 4:139445925-139445947 GACAGCTTTTGGCCTGTTACTGG + Intergenic
981303796 4:143223628-143223650 GGCACTGTTTGTCCAGTTACTGG + Exonic
981835004 4:149043953-149043975 GACAGCTCTTGGCCTGTTACTGG + Intergenic
982623340 4:157732893-157732915 GACAGCTCTTGGCCTGTTACTGG - Intergenic
982847770 4:160274304-160274326 GACAGCTCTTGGCCTGTTACTGG + Intergenic
983027391 4:162755303-162755325 GACAGCTCTTGGCCTGTTACTGG + Intergenic
986037032 5:3950429-3950451 GACAGCTCTTGGCCTGTTACTGG - Intergenic
986742920 5:10719514-10719536 GACAGCTCTTGGCCTGTTACTGG + Intronic
987507550 5:18793124-18793146 GCCCCCTTTTCTCCTGTGAGAGG - Intergenic
987578340 5:19758303-19758325 GGCAGCTCTTGGCCTGTTACTGG - Intronic
988079830 5:26401411-26401433 GACAACTCTTGGCCTGTTACTGG - Intergenic
988169201 5:27632829-27632851 GTCAGCTTTTGGCCAGTTACTGG - Intergenic
988188776 5:27901245-27901267 GACAGCTCTTGGCCTGTTACTGG + Intergenic
989045205 5:37267582-37267604 GACAGCTCTTGGCCTGTTACTGG - Intergenic
989486383 5:41996350-41996372 GACAGCTCTTGGCCTGTTACTGG - Intergenic
991033545 5:62105931-62105953 GACAGCTCTTGGCCTGTTACTGG + Intergenic
991946146 5:71900150-71900172 GACAGCTGTTGGCCTGTTACTGG + Intergenic
992411084 5:76505846-76505868 CCCACCTTTATTCCTGTTCCTGG + Intronic
993231900 5:85247524-85247546 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994291372 5:98031962-98031984 GACAGCTCTTGGCCTGTTACTGG - Intergenic
994373875 5:98996438-98996460 GCCACCTATTTTCCTGTTCCAGG + Intergenic
994984419 5:106915720-106915742 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995545226 5:113223506-113223528 GCCACCAGTCTTCCTGTTACAGG - Intronic
995776286 5:115727670-115727692 GACAGCTCTTGGCCTGTTACTGG - Intergenic
995782874 5:115796695-115796717 GCCACATTCTGCTCTGTTACAGG - Intergenic
996164955 5:120212499-120212521 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1001173596 5:169444652-169444674 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1002727102 5:181306574-181306596 GCCACCTTATTTTCTATTACTGG + Intergenic
1003444432 6:6171783-6171805 GCCACCTTTGTTCCTGATTCTGG + Intronic
1003695897 6:8406130-8406152 GACAGCTCTTGGCCTGTTACAGG - Intergenic
1003758608 6:9150091-9150113 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1008079357 6:47178390-47178412 CTCTCCTTTTGGCCTGTTACTGG - Intergenic
1008266921 6:49439279-49439301 GACAGCTCTTGGCCTGTTACTGG - Intronic
1009390111 6:63135068-63135090 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1010119545 6:72358755-72358777 GACACCTTTTGCATTGTTACAGG + Intronic
1010323578 6:74540499-74540521 GACACCTCTTGGCCTGTTACTGG + Intergenic
1010325329 6:74556589-74556611 GACATCTCTTGGCCTGTTACTGG - Intergenic
1010580752 6:77593895-77593917 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1010938245 6:81886407-81886429 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1011052792 6:83172222-83172244 CCCACATTTTGACCTGTCACAGG - Intronic
1012001906 6:93664456-93664478 GACAGCTTTTAACCTGTTACTGG + Intergenic
1012401316 6:98844799-98844821 GCCACCTTTTGTGTTGGTCCGGG + Intergenic
1012730462 6:102874329-102874351 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1012920794 6:105219535-105219557 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1013835059 6:114324907-114324929 GACAACTTTAGTCCTGTGACTGG + Intronic
1014631641 6:123796811-123796833 GACATCTCTTGACCTGTTACTGG + Intergenic
1015095449 6:129409591-129409613 GACAACTCTTGGCCTGTTACTGG - Intronic
1016144291 6:140649412-140649434 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1016147329 6:140692706-140692728 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1016184118 6:141179339-141179361 GGCACCTTCAGTCCTGTCACTGG - Intergenic
1016419614 6:143870672-143870694 GACAGCTCTTGGCCTGTTACTGG - Intronic
1017551968 6:155518655-155518677 GCCACCTTCTGTCGTGTTTTGGG + Intergenic
1018803791 6:167242981-167243003 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1020396718 7:7725524-7725546 GACAGCTCTTGGCCTGTTACTGG + Intronic
1020710350 7:11597635-11597657 GACAGCTCTTGGCCTGTTACTGG + Intronic
1021988810 7:26122932-26122954 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1022887692 7:34663285-34663307 GCCACATTCTCTCCTGGTACAGG + Intronic
1024040538 7:45550154-45550176 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1024744207 7:52388453-52388475 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1025118366 7:56278107-56278129 GCCAGCATTGGTCCTGTGACAGG + Intergenic
1027685798 7:81277964-81277986 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1028180017 7:87708680-87708702 TCCACCTTCTTTCCTGTTTCAGG - Intronic
1028935014 7:96455072-96455094 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1030457463 7:109793043-109793065 GACAACTCTTGGCCTGTTACTGG - Intergenic
1031236827 7:119188024-119188046 GACAGCTCTTGGCCTGTTACAGG + Intergenic
1031676558 7:124618373-124618395 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1032048627 7:128631791-128631813 GCCACCTTATTTTCTATTACTGG + Intergenic
1032153104 7:129446949-129446971 GACAGCTCTTGGCCTGTTACTGG - Intronic
1032923470 7:136576107-136576129 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1034517269 7:151590650-151590672 GCCACCCCTTGACCTGTAACTGG + Intronic
1044262951 8:90148880-90148902 GCCACCTTGTGCCCTGCTCCTGG + Intergenic
1044625406 8:94231816-94231838 CTCACCTATTGTCCTGTTGCTGG - Intergenic
1045221839 8:100207073-100207095 GACAGCTCTTGGCCTGTTACTGG + Intronic
1046128673 8:109941594-109941616 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1046197558 8:110884231-110884253 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1046585785 8:116147711-116147733 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1047622623 8:126623349-126623371 GCAACCTTGTTTCCTGTTTCTGG + Intergenic
1047744885 8:127837313-127837335 GCCTTCTTTTTTCCTTTTACAGG - Intergenic
1048646944 8:136431700-136431722 GCCACCTTATGTCCTTTGATTGG - Intergenic
1049908950 9:246507-246529 GCCTCCTTTTTTCCTGAGACAGG - Intronic
1052227590 9:26108384-26108406 GACAGCTCTTGGCCTGTTACTGG + Intronic
1053092491 9:35291817-35291839 GCCAAAGTTTGTCCTGTCACTGG + Intronic
1055499769 9:76891359-76891381 GTCACCTGTTGTCCCATTACAGG + Intronic
1055903940 9:81271196-81271218 GATACCTCTTGGCCTGTTACTGG - Intergenic
1056156667 9:83845217-83845239 GACAGCTCTTGGCCTGTTACTGG + Intronic
1056314234 9:85372937-85372959 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056353871 9:85778310-85778332 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1056719864 9:89062428-89062450 GGAACCTTTTGTCCTTTCACTGG + Intronic
1057185666 9:93056291-93056313 GCCTCCATTTGTACTGTTAGGGG - Intergenic
1057691162 9:97287714-97287736 TCCACATTTTGGTCTGTTACAGG + Intergenic
1062135472 9:134925031-134925053 GACAGCTCTTGACCTGTTACAGG + Intergenic
1062752224 9:138264050-138264072 GCCACCTTATTTTCTATTACTGG + Intergenic
1186279496 X:7977126-7977148 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1186384093 X:9091754-9091776 GACAGCTCTTGGCCTGTTACTGG - Intronic
1187604866 X:20871870-20871892 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1190996749 X:55617475-55617497 CTCTCCTTTTGACCTGTTACTGG - Intergenic
1191134033 X:57044480-57044502 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191630037 X:63312581-63312603 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1191769494 X:64740091-64740113 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1191932926 X:66394170-66394192 GACAGCTTTTGGCCTGTTACTGG + Intergenic
1193053491 X:77125774-77125796 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1193356256 X:80523129-80523151 GACAACTCTTGGCCTGTTACTGG + Intergenic
1193832948 X:86310103-86310125 GACAGCTCTTGACCTGTTACTGG + Intronic
1193957285 X:87878216-87878238 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194179590 X:90695929-90695951 GACAACTCTTGGCCTGTTACTGG - Intergenic
1194443550 X:93961109-93961131 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1194513417 X:94822246-94822268 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1194604389 X:95961962-95961984 GACAGCTTTTGGCCTGTTACTGG - Intergenic
1194833959 X:98658810-98658832 GCGAGCTCTTGGCCTGTTACTGG + Intergenic
1195782352 X:108479859-108479881 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197044415 X:121978331-121978353 GACAACTCTTGGCCTGTTACTGG + Intergenic
1197097469 X:122612844-122612866 GACAGGTTTTGGCCTGTTACTGG + Intergenic
1197245045 X:124158988-124159010 GACAGCTCTTGGCCTGTTACTGG - Intronic
1197372055 X:125637860-125637882 GGCAGCTCTTGGCCTGTTACTGG - Intergenic
1197477358 X:126941323-126941345 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198783039 X:140257791-140257813 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1198830378 X:140744178-140744200 GCCAACTTCTGATCTGTTACTGG + Intergenic
1198934041 X:141887885-141887907 GACAGCTCTTGGCCTGTTACTGG + Intronic
1200340494 X:155390636-155390658 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1200521271 Y:4212036-4212058 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1200526252 Y:4278098-4278120 GACAACTCTTGGCCTGTTACTGG - Intergenic
1200931828 Y:8703715-8703737 GCCACCTTTTGCCCTATGCCAGG - Intergenic
1200976630 Y:9218486-9218508 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201798428 Y:17926705-17926727 GACAGCTCTTGGCCTGTTACTGG + Intergenic
1201803125 Y:17979252-17979274 GACAGCTCTTGGCCTGTTACTGG - Intergenic
1202359748 Y:24095395-24095417 GACAACTCTTGGCCTGTTACTGG + Intergenic
1202511030 Y:25574719-25574741 GACAACTCTTGGCCTGTTACTGG - Intergenic