ID: 924256191

View in Genome Browser
Species Human (GRCh38)
Location 1:242185210-242185232
Sequence ATTCATTGGAGTAGCTATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924256191_924256197 17 Left 924256191 1:242185210-242185232 CCCACATAGCTACTCCAATGAAT 0: 1
1: 0
2: 0
3: 6
4: 179
Right 924256197 1:242185250-242185272 ATGCAATGGGAACCTACCACAGG 0: 1
1: 0
2: 0
3: 5
4: 92
924256191_924256198 22 Left 924256191 1:242185210-242185232 CCCACATAGCTACTCCAATGAAT 0: 1
1: 0
2: 0
3: 6
4: 179
Right 924256198 1:242185255-242185277 ATGGGAACCTACCACAGGCCAGG 0: 1
1: 0
2: 1
3: 14
4: 200
924256191_924256194 3 Left 924256191 1:242185210-242185232 CCCACATAGCTACTCCAATGAAT 0: 1
1: 0
2: 0
3: 6
4: 179
Right 924256194 1:242185236-242185258 GCTTTGTTTGCCAAATGCAATGG 0: 1
1: 0
2: 2
3: 21
4: 196
924256191_924256195 4 Left 924256191 1:242185210-242185232 CCCACATAGCTACTCCAATGAAT 0: 1
1: 0
2: 0
3: 6
4: 179
Right 924256195 1:242185237-242185259 CTTTGTTTGCCAAATGCAATGGG 0: 1
1: 0
2: 4
3: 22
4: 213
924256191_924256199 23 Left 924256191 1:242185210-242185232 CCCACATAGCTACTCCAATGAAT 0: 1
1: 0
2: 0
3: 6
4: 179
Right 924256199 1:242185256-242185278 TGGGAACCTACCACAGGCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924256191 Original CRISPR ATTCATTGGAGTAGCTATGT GGG (reversed) Intronic
903153055 1:21426859-21426881 TTTCATTGCAGTAGATATTTAGG - Intergenic
903160073 1:21481122-21481144 TTTCATTGCAGTAGATATTTAGG + Intronic
904816314 1:33203093-33203115 ATACAGTGTTGTAGCTATGTAGG - Intergenic
904846764 1:33425235-33425257 CTTCACTGGAGTAGATAAGTTGG + Intronic
909872579 1:80761509-80761531 ATTCTTTGGAGCAGCTATTATGG + Intergenic
910143277 1:84050795-84050817 TTGCATTGCAGCAGCTATGTTGG - Intergenic
910484129 1:87693111-87693133 ATTCATTGGTGAAGCTATCTGGG - Intergenic
911681439 1:100720593-100720615 ATTCAGTGGACTATCTATCTGGG - Exonic
913605717 1:120463866-120463888 TTTCATTGCAGTAGATATTTAGG + Intergenic
913643134 1:120831488-120831510 TTTCATTGCAGTAGATATTTAGG + Intronic
913643901 1:120838241-120838263 TTTCATTGCAGTAGATATTTAGG + Intronic
913989635 1:143598958-143598980 TTTCATTGCAGTAGATATTTAGG - Intergenic
914082831 1:144425356-144425378 TTTCATTGCAGTAGATATTTAGG - Intronic
914177747 1:145293860-145293882 TTTCATTGCAGTAGATATTTAGG - Intronic
914178292 1:145298626-145298648 TTTCATTGCAGTAGATATTTAGG - Intronic
914178837 1:145303372-145303394 TTTCATTGCAGTAGATATTTAGG - Intronic
914179215 1:145306555-145306577 TTTCATTGCAGTAGATATTTAGG - Intronic
914179590 1:145309736-145309758 TTTCATTGCAGTAGATATTTAGG - Intronic
914180135 1:145314504-145314526 TTTCATTGCAGTAGATATTTAGG - Intronic
914180680 1:145319274-145319296 TTTCATTGCAGTAGATATTTAGG - Intronic
914181223 1:145324024-145324046 TTTCATTGCAGTAGATATTTAGG - Intronic
914181766 1:145328784-145328806 TTTCATTGCAGTAGATATTTAGG - Intronic
914182311 1:145333537-145333559 TTTCATTGCAGTAGATATTTAGG - Intronic
914182856 1:145338293-145338315 TTTCATTGCAGTAGATATTTAGG - Intronic
914183401 1:145343047-145343069 TTTCATTGCAGTAGATATTTAGG - Intronic
914183945 1:145347817-145347839 TTTCATTGCAGTAGATATTTAGG - Intronic
914184489 1:145352581-145352603 TTTCATTGCAGTAGATATTTAGG - Intronic
914185033 1:145357329-145357351 TTTCATTGCAGTAGATATTTAGG - Intronic
914185578 1:145362082-145362104 TTTCATTGCAGTAGATATTTAGG - Intronic
914186124 1:145366842-145366864 TTTCATTGCAGTAGATATTTAGG - Intronic
914186670 1:145371590-145371612 TTTCATTGCAGTAGATATTTAGG - Intronic
914187214 1:145376344-145376366 TTTCATTGCAGTAGATATTTAGG - Intronic
914187757 1:145381096-145381118 TTTCATTGCAGTAGATATTTAGG - Intronic
914188302 1:145385852-145385874 TTTCATTGCAGTAGATATTTAGG - Intronic
914188845 1:145390608-145390630 TTTCATTGCAGTAGATATTTAGG - Intronic
914269997 1:146071807-146071829 TTTCATTGCAGTAGATATTTAGG - Intronic
914270538 1:146076545-146076567 TTTCATTGCAGTAGATATTTAGG - Intronic
914271074 1:146081275-146081297 TTTCATTGCAGTAGATATTTAGG - Intronic
914271612 1:146086003-146086025 TTTCATTGCAGTAGATATTTAGG - Intronic
914272147 1:146090720-146090742 TTTCATTGCAGTAGATATTTAGG - Intronic
914272683 1:146095442-146095464 TTTCATTGCAGTAGATATTTAGG - Intronic
914273221 1:146100164-146100186 TTTCATTGCAGTAGATATTTAGG - Intronic
914273760 1:146104882-146104904 TTTCATTGCAGTAGATATTTAGG - Intronic
914274298 1:146109590-146109612 TTTCATTGCAGTAGATATTTAGG - Intronic
914274834 1:146114308-146114330 TTTCATTGCAGTAGATATTTAGG - Intronic
914275368 1:146119034-146119056 TTTCATTGCAGTAGATATTTAGG - Intronic
914275903 1:146123766-146123788 TTTCATTGCAGTAGATATTTAGG - Intronic
914366929 1:146987424-146987446 TTTCATTGCAGTAGATATTTAGG + Intronic
914485519 1:148106020-148106042 TTTCATTGCAGTAGATATTTAGG - Intronic
914532836 1:148538488-148538510 TTTCATTGCAGTAGATATTTAGG - Intronic
914533370 1:148543202-148543224 TTTCATTGCAGTAGATATTTAGG - Intronic
914533905 1:148547910-148547932 TTTCATTGCAGTAGATATTTAGG - Intronic
914534441 1:148552618-148552640 TTTCATTGCAGTAGATATTTAGG - Intronic
914534977 1:148557330-148557352 TTTCATTGCAGTAGATATTTAGG - Intronic
914535512 1:148562075-148562097 TTTCATTGCAGTAGATATTTAGG - Intronic
914536048 1:148566791-148566813 TTTCATTGCAGTAGATATTTAGG - Intronic
914536583 1:148571521-148571543 TTTCATTGCAGTAGATATTTAGG - Intronic
914536944 1:148574717-148574739 TTTCATTGCAGTAGATATTTAGG - Intronic
914585489 1:149058003-149058025 TTTCATTGCAGTAGATATTTAGG - Intronic
914585855 1:149061171-149061193 TTTCATTGCAGTAGATATTTAGG - Intronic
914628979 1:149490633-149490655 TTTCATTGCAGTAGATATTTAGG + Intergenic
914629512 1:149495390-149495412 TTTCATTGCAGTAGATATTTAGG + Intergenic
914630047 1:149500145-149500167 TTTCATTGCAGTAGATATTTAGG + Intergenic
914630581 1:149504906-149504928 TTTCATTGCAGTAGATATTTAGG + Intergenic
914631114 1:149509667-149509689 TTTCATTGCAGTAGATATTTAGG + Intergenic
914631646 1:149514428-149514450 TTTCATTGCAGTAGATATTTAGG + Intergenic
914632182 1:149519182-149519204 TTTCATTGCAGTAGATATTTAGG + Intergenic
914632719 1:149523937-149523959 TTTCATTGCAGTAGATATTTAGG + Intergenic
914633254 1:149528686-149528708 TTTCATTGCAGTAGATATTTAGG + Intergenic
914633789 1:149533417-149533439 TTTCATTGCAGTAGATATTTAGG + Intergenic
914634325 1:149538172-149538194 TTTCATTGCAGTAGATATTTAGG + Intergenic
914634859 1:149542925-149542947 TTTCATTGCAGTAGATATTTAGG + Intergenic
914635394 1:149547662-149547684 TTTCATTGCAGTAGATATTTAGG + Intergenic
914635929 1:149552399-149552421 TTTCATTGCAGTAGATATTTAGG + Intergenic
914938179 1:151998804-151998826 CCTCATTGGACTAGCTATGTGGG + Intergenic
915171153 1:153977956-153977978 ATCCAGTGGAGAAGCTGTGTTGG + Intergenic
918524957 1:185455308-185455330 ATTCATTGGAGTTTCTATTTAGG - Intergenic
921058030 1:211559115-211559137 ATGCATTGGAGGAACTAGGTTGG - Intergenic
921696522 1:218217079-218217101 TTTCAATGGAGTTGATATGTTGG + Intergenic
923334634 1:232957299-232957321 ATTCACTAGAGAAGCCATGTGGG + Intronic
923990992 1:239436768-239436790 ATTCATTTTAGTTGCCATGTGGG + Intronic
924256191 1:242185210-242185232 ATTCATTGGAGTAGCTATGTGGG - Intronic
1064957459 10:20926628-20926650 ATTCATTGGAATAGCCAGGGAGG + Intronic
1065096358 10:22284711-22284733 TTTCACTGGAGTAGCTACCTTGG - Intergenic
1068742444 10:60489201-60489223 GTGCATTGGAGAAGCTATCTTGG - Intronic
1073877736 10:107945228-107945250 ATCCAATGGAGTAGGAATGTGGG - Intergenic
1076409405 10:130235075-130235097 ATTCATTGCAGCAGCTATAGAGG - Intergenic
1078227742 11:9408097-9408119 ATTAGTTGTAGAAGCTATGTTGG + Intronic
1078725529 11:13927157-13927179 ATTCCTGAGAGTAGCTATGAAGG - Intergenic
1078904742 11:15673332-15673354 TTGCATTGGAGTAGCTAAGGAGG - Intergenic
1079356153 11:19731681-19731703 ATTGAGTTGAGTAGCTATGTGGG + Intronic
1079781156 11:24607788-24607810 ATTCATTGTAGTACATCTGTTGG + Intronic
1092044035 12:5413742-5413764 ATTCATTGGGGAAGTTATCTAGG + Intergenic
1092573876 12:9757389-9757411 ATACATAGGAGTAGGTTTGTTGG - Intronic
1093238176 12:16637925-16637947 ATACCTAGGAGTAGCTCTGTTGG + Intergenic
1095611273 12:44130959-44130981 TTTCATAGGACTAGCTGTGTTGG + Intronic
1095822900 12:46498849-46498871 AGTCATTGGAATAGAAATGTAGG + Intergenic
1097792311 12:63828162-63828184 ATTCATTTTAATTGCTATGTAGG - Intergenic
1098066363 12:66621594-66621616 ATTCTTTGGGGTATATATGTAGG + Intronic
1098709753 12:73740885-73740907 ATTCATTGGAGTTATTATATAGG - Intergenic
1101271563 12:103151265-103151287 ATTCATTGGTGAAGCCATCTGGG - Intergenic
1101550789 12:105759700-105759722 ATTCATTGGAGATGTTATGGTGG + Intergenic
1111827228 13:93282493-93282515 ATTCATTAGATCAGCTAAGTTGG - Intronic
1115275460 14:31603506-31603528 ATTTATTGGATTATCTCTGTAGG + Intronic
1115724841 14:36201761-36201783 ATTTCTTAGAGTAGCTTTGTGGG + Intergenic
1116164847 14:41322513-41322535 ATGCATAGGACAAGCTATGTGGG - Intergenic
1119335890 14:73833479-73833501 ATTCATTGGAGTATGCATTTTGG + Intergenic
1120275767 14:82370688-82370710 ATTCCTGGGTGTGGCTATGTGGG + Intergenic
1123999107 15:25740062-25740084 ATTCATTCAAGTAGCAATCTGGG - Intronic
1124062711 15:26308678-26308700 CTTCATTGGATTACCTATGGGGG + Intergenic
1127948613 15:63781815-63781837 ATTCATTGGAGTGGCTTTCTTGG - Intronic
1129941615 15:79501883-79501905 ATTCATTGATGTAGTTATGGAGG - Intergenic
1130808014 15:87347533-87347555 ATTCATTGCAGTAACTGTTTTGG - Intergenic
1131743814 15:95422945-95422967 ATTCATTTGAGTAAATATGAAGG - Intergenic
1136178485 16:28534820-28534842 AGGTATTGGAGTAGCTATTTTGG + Intronic
1141350824 16:83294291-83294313 ATTCATTGTAGTTGCCATATTGG + Intronic
1148407532 17:47430510-47430532 ATTCATAGGTGAAGCCATGTGGG + Intronic
1149834883 17:59903561-59903583 ATACATTGGAGTAGATTTGCTGG + Intronic
1149944993 17:60915349-60915371 ATTCATTGGTGTGTTTATGTGGG + Intronic
1156532695 18:37833577-37833599 ATTCATTGTAATAGCTGTGCAGG - Intergenic
1158380538 18:56925266-56925288 TTTCATTTGAGTAGACATGTAGG + Intronic
1162245378 19:9395585-9395607 AATCAATGGTGTGGCTATGTGGG + Intergenic
1163164628 19:15487349-15487371 ATTCATTTACGTAGCTATGGTGG + Intronic
1164909853 19:31999915-31999937 ATTCATTAGTGTAGCCATCTGGG - Intergenic
1165368252 19:35383623-35383645 ATTCATTGTAGTAACAATGCTGG + Intergenic
1202676114 1_KI270711v1_random:8443-8465 TTTCATTGCAGTAGATATTTAGG - Intergenic
928835979 2:35545518-35545540 GTGCATTGGAGTAGTTAGGTGGG + Intergenic
934705807 2:96479304-96479326 ATTCCTTGGAGTACCTATCTAGG + Intergenic
936341487 2:111637393-111637415 ATTCAATCCAGTATCTATGTGGG + Intergenic
939413900 2:141867403-141867425 ATTCATGGGAGTAGTCATTTTGG - Intronic
939681309 2:145137329-145137351 ACTCCTTGGAATTGCTATGTCGG + Intergenic
940905169 2:159162494-159162516 ACTCTTTGTAGAAGCTATGTAGG + Intronic
941537975 2:166744833-166744855 GTTCATTAGAGGAGCTTTGTTGG + Intergenic
942146607 2:173033079-173033101 ATCTATTGGTGTAGATATGTGGG + Intronic
943396411 2:187340661-187340683 ATTCAGTGGTGAAGCTATCTAGG - Intergenic
945659604 2:212669382-212669404 ATTCATTGTTTTAGGTATGTAGG + Intergenic
946764666 2:223029443-223029465 ACTCTCTGGAGTTGCTATGTGGG + Intergenic
1176096878 20:63348419-63348441 ATTCAGTGGGGTGGCTGTGTGGG + Intronic
1178675599 21:34628938-34628960 ATTCATTGGAAGAGCCATCTGGG + Intergenic
1179835942 21:44033558-44033580 ATTAAATGGAGAAACTATGTAGG + Intronic
957354872 3:79068817-79068839 TTTCATTGGATTAGATAAGTAGG - Intronic
960382117 3:116975810-116975832 ATACATTGAAGTAGCTTTCTTGG - Intronic
961605209 3:128088952-128088974 ATTCATTCAAGTAGCTATTCAGG - Intronic
963173323 3:142273038-142273060 AGTCATTGGATCAGCTATGAAGG + Intergenic
965811257 3:172593258-172593280 TTTCATAGGAGTAGGTATGGGGG + Intergenic
970581962 4:17481740-17481762 CTTCATTGGAGAAGGTATGGCGG - Intronic
971535621 4:27746715-27746737 ATCAAGTGGAGTTGCTATGTTGG - Intergenic
971994260 4:33943769-33943791 TTTCATTAGAGTAGCTTTGCTGG + Intergenic
972088890 4:35255961-35255983 ATTCCTTGGAGTACATGTGTAGG + Intergenic
975920545 4:79380762-79380784 ATTAATGGCAGTAGCAATGTTGG - Intergenic
977256706 4:94749010-94749032 AATCATGGGAGTTGCTATCTGGG - Intergenic
978149645 4:105417692-105417714 ATTAATGGGTGTAGGTATGTAGG - Intronic
978937702 4:114398436-114398458 ATGCCTTGGAGTAGGTATTTTGG - Intergenic
990335935 5:54772799-54772821 ATGCAATGGAGTAAATATGTTGG + Intergenic
991206522 5:64055943-64055965 ATTCATTGGAGAAGTTTTGGAGG + Intergenic
992035989 5:72776613-72776635 GTTCATTGCTGTAGCTTTGTTGG - Intergenic
992195141 5:74331566-74331588 ATTCATTGGTGGATATATGTAGG - Intergenic
993659387 5:90612496-90612518 ATTCAGTTAAGTGGCTATGTAGG - Intronic
997405331 5:133641530-133641552 ATTCTTTGGAGTAGAAGTGTTGG - Intergenic
998714667 5:144869160-144869182 ATTTATAGGAGTAGCACTGTTGG + Intergenic
1003761155 6:9180434-9180456 CTTCATTGGAGTTTTTATGTGGG - Intergenic
1006427054 6:33971911-33971933 ATTCATTCTAGGAGCTATTTGGG - Intergenic
1013203127 6:107920693-107920715 ATTCAATGTAAGAGCTATGTGGG + Intronic
1016555107 6:145327482-145327504 ATTCATTGGGACAGCTATGACGG - Intergenic
1017111539 6:150937317-150937339 GCTCATTGGAGTTGCTGTGTGGG + Intronic
1019267708 7:127633-127655 ATTCATTGGAGTTGTTTTCTGGG + Intergenic
1020540139 7:9452197-9452219 ATTCATTGAAGATGATATGTTGG - Intergenic
1023350096 7:39311643-39311665 ATTCAATGATCTAGCTATGTAGG + Intronic
1030157979 7:106476244-106476266 AATTAATGGAGTAGCTATGGTGG + Intergenic
1031661924 7:124436246-124436268 ATTAATTGGATTTGCTATATGGG + Intergenic
1033844955 7:145420632-145420654 ATTCATTTGAGTAAATATGAAGG - Intergenic
1034068863 7:148163407-148163429 ATTCATTGTAGAGGCTATGGTGG - Intronic
1038390316 8:27192316-27192338 CATCACTGTAGTAGCTATGTTGG - Intergenic
1047009874 8:120660615-120660637 ATTCACTGGAGTAGCACTTTTGG + Intronic
1050689086 9:8204883-8204905 ATTAATTGGGGTGGGTATGTGGG + Intergenic
1051102614 9:13538961-13538983 ATTGATTGGAGACACTATGTTGG + Intergenic
1056690948 9:88808254-88808276 GTTCATTGGAGCAGCTATAGAGG - Intergenic
1057007224 9:91571105-91571127 ATTCACTGGAGAAGCTAAGCAGG - Intronic
1059853545 9:118369626-118369648 ATTCTTTGGATTACATATGTAGG - Intergenic
1187434405 X:19253798-19253820 ACACATTGGAATAGCTATGGAGG + Intergenic
1189350388 X:40271403-40271425 TTTCATTGGAGGAATTATGTGGG + Intergenic
1191191473 X:57673226-57673248 CTTCATTGGATTAGCTATTGGGG - Intergenic
1192163402 X:68806382-68806404 ATTCTTTAGAGTATATATGTAGG - Intergenic
1193760035 X:85453461-85453483 ATTAATTGAAGTAGGTCTGTTGG + Intergenic
1196774313 X:119324551-119324573 ACTGAATGGAATAGCTATGTGGG - Intergenic
1198567208 X:137916689-137916711 ATTCTCTGGGGTAGCTTTGTTGG + Intergenic