ID: 924258372

View in Genome Browser
Species Human (GRCh38)
Location 1:242204651-242204673
Sequence CATGCTGCAGTGATGGCACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 1, 2: 0, 3: 18, 4: 206}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924258369_924258372 20 Left 924258369 1:242204608-242204630 CCTAGTCATCAACTCAAATGGCT 0: 1
1: 0
2: 2
3: 10
4: 128
Right 924258372 1:242204651-242204673 CATGCTGCAGTGATGGCACTAGG 0: 1
1: 1
2: 0
3: 18
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924258372 Original CRISPR CATGCTGCAGTGATGGCACT AGG Intronic
900038937 1:440978-441000 CATTCTGCATTGATCTCACTGGG - Intergenic
900060369 1:675954-675976 CATTCTGCATTGATCTCACTGGG - Intergenic
902395492 1:16130326-16130348 CATGATGCAGTGCTGGCAGCAGG - Exonic
905927550 1:41762636-41762658 CCTGCTCCTGTGCTGGCACTTGG + Intronic
906341048 1:44981137-44981159 CAAGCAGTAGTGATGGCAGTAGG - Exonic
909049665 1:70752920-70752942 CAAGCTGGAGTGATGGCTCAGGG + Intergenic
910130295 1:83896536-83896558 CATGCAGCAGCGATGGCTATAGG + Intronic
913116527 1:115702561-115702583 CATTGTGCAGTGATGGCTCCTGG + Intronic
918071946 1:181139686-181139708 CATGCTGCAGAGGTGGGCCTAGG + Intergenic
919122288 1:193356320-193356342 CATGGTGCAAGGATAGCACTGGG - Intergenic
920182371 1:204140241-204140263 ACTGCTGCAGTGATGGGATTGGG - Intronic
920462289 1:206150395-206150417 CATGCAACAGTCATGGAACTTGG - Intergenic
922653116 1:227357980-227358002 CAGGCTGCAACCATGGCACTTGG + Intergenic
924012088 1:239676490-239676512 CATGCTGCAGAGTGGGCTCTGGG - Intronic
924258372 1:242204651-242204673 CATGCTGCAGTGATGGCACTAGG + Intronic
1064463738 10:15559254-15559276 CATGCTGGAGTGAAGGACCTTGG - Intronic
1069092935 10:64223754-64223776 CTAGCTGCAGTGAAGGCAGTGGG - Intergenic
1069808206 10:71139115-71139137 CTTTCTGCAGTCTTGGCACTCGG - Intergenic
1072948056 10:99828299-99828321 GATGCTGCTGTGTTGGCCCTGGG + Intronic
1073942856 10:108718148-108718170 CATGCTCCAGTAGTGTCACTGGG + Intergenic
1075627688 10:123974290-123974312 CATCCTGCTGGGATGGCACAGGG + Intergenic
1075859462 10:125662157-125662179 CAACCGGCAGTGATGGCTCTGGG - Intronic
1076000660 10:126910416-126910438 CTTGCTACAGCGATGGCCCTGGG - Intronic
1076965144 11:76889-76911 CATTCTGCATTGATCTCACTGGG - Intergenic
1077102527 11:828478-828500 CCTGCTGCAGGGAGGGCCCTCGG + Intronic
1077223354 11:1427021-1427043 CAGGTGGCAGTGTTGGCACTGGG - Intronic
1077753263 11:4997690-4997712 CATACTGTGTTGATGGCACTTGG - Intergenic
1077929569 11:6716903-6716925 CCTGCTTCAGTGATGTCATTAGG - Intergenic
1079598148 11:22278635-22278657 CATACAGGAGTGATGTCACTTGG + Intronic
1081152469 11:39648723-39648745 CAAGCAGCCGTGGTGGCACTGGG - Intergenic
1083009175 11:59379022-59379044 CATCTTGCAGTGATGCAACTGGG + Intergenic
1084615183 11:70231132-70231154 CATGCTGCTGTGAAGTCACCTGG - Intergenic
1088212166 11:107468762-107468784 CATACAGATGTGATGGCACTGGG - Intergenic
1089383047 11:118049954-118049976 CATGCTGAAGTGGAGTCACTGGG + Intergenic
1090631179 11:128650124-128650146 CATGCTGGATTAAGGGCACTTGG - Intergenic
1090896212 11:130977483-130977505 CATTCTGCATTGACTGCACTGGG + Intergenic
1091114948 11:133004424-133004446 CATGCTGCCTTGCTGGGACTTGG - Intronic
1091822013 12:3482528-3482550 CAAGCTGGAGTGACAGCACTTGG + Intronic
1094210206 12:27881807-27881829 CATTCAGCAGTGATGGCATCAGG + Intergenic
1094299150 12:28941405-28941427 CATGCTGCACTTATTGCACAGGG - Intergenic
1095110430 12:38289002-38289024 CATCCTGCTGACATGGCACTGGG + Intergenic
1097032084 12:56097104-56097126 CAAGCTGCAGAGATGACCCTGGG - Exonic
1099230083 12:80013755-80013777 CCTGCTGCAGTGGTGGCAATAGG + Intergenic
1102579453 12:113877027-113877049 CAAGCCACAGAGATGGCACTTGG + Intronic
1104165780 12:126228354-126228376 CATCCTAAAGTGATGGTACTTGG - Intergenic
1104528931 12:129550601-129550623 CAGTCTGCAGTAATGACACTGGG + Intronic
1105575004 13:21642403-21642425 CAAGGTGAAGTGATGGCATTAGG + Intergenic
1106238000 13:27881615-27881637 CAAGCTGTAAAGATGGCACTGGG + Intergenic
1106893483 13:34271902-34271924 ACTGCTGCAGTGAATGCACTAGG + Intergenic
1107026460 13:35806765-35806787 GATCCTGCAGTGATGGCATGGGG + Intronic
1107583681 13:41820421-41820443 CCTGTTGTATTGATGGCACTTGG - Intronic
1107658327 13:42614237-42614259 CATGCTGCACTGAGGACACTTGG + Intergenic
1108441699 13:50459827-50459849 CACTATGCAGTGATAGCACTAGG - Intronic
1112332603 13:98488050-98488072 CATTCTGCAGTGTTGGGAATTGG - Intronic
1113426979 13:110216269-110216291 CACCCTGCAGTGATGGCCCCAGG + Intronic
1113552061 13:111200199-111200221 GATGCAGCAGGGAGGGCACTGGG - Intronic
1113855981 13:113445669-113445691 CATGGGGCAGAAATGGCACTTGG + Intronic
1114459932 14:22879849-22879871 CCTGCCCAAGTGATGGCACTGGG + Exonic
1116243595 14:42379346-42379368 CTTGCAGCAGTGTTGGCACAAGG - Intergenic
1117835772 14:59804409-59804431 AATGTTGCAGTGAAGGCACCAGG - Intronic
1118939843 14:70323544-70323566 GATGTTGCAGTGATCACACTGGG - Intergenic
1118979330 14:70703376-70703398 CATATTGAAGTGATGGTACTAGG - Intergenic
1120393204 14:83934674-83934696 CATGCTGGAGTGATGGTGATTGG + Intergenic
1120765644 14:88324543-88324565 CATAGCACAGTGATGGCACTTGG - Intronic
1120895849 14:89531556-89531578 AATGCTCCAGTGATAGCACTGGG - Intronic
1121174138 14:91877791-91877813 CATTCTACAGTTATGGCATTTGG - Intronic
1128135511 15:65260340-65260362 CACACTGCAGAGATGGAACTAGG + Intronic
1130557864 15:84935527-84935549 CCTGCTGCAGGGAAGGGACTGGG - Intronic
1131368921 15:91863482-91863504 AGTGCTGCTGTGATAGCACTTGG + Intronic
1131509355 15:93041036-93041058 CATGGAGCAGGGGTGGCACTTGG - Intronic
1132442983 15:101886629-101886651 CATTCTGCATTGATCTCACTGGG + Intergenic
1133927251 16:10203236-10203258 CAGGCTGCAGTCAGGGCATTGGG - Intergenic
1134889917 16:17831583-17831605 CGTGCTGCCATGATGGCAGTGGG - Intergenic
1137668894 16:50267831-50267853 CTTCCTGCAGGGCTGGCACTTGG - Intronic
1139948942 16:70660058-70660080 CATACTGCAATGAGGGCTCTGGG - Exonic
1141244441 16:82293083-82293105 CATGCAGCAAGGATGGCTCTTGG - Intergenic
1144960985 17:19043823-19043845 CATGCAGCAGTGCGGACACTGGG + Intronic
1144974175 17:19130701-19130723 CATGCAGCAGTGCGGACACTGGG - Intronic
1146061831 17:29611909-29611931 TCTTCTGCAGTGATGGCAGTGGG - Exonic
1146845529 17:36179400-36179422 CCTGCTGCAGAGATGGGCCTGGG + Intronic
1146873745 17:36391241-36391263 CCTGCTGCAGAGATGGGCCTGGG + Intronic
1146881103 17:36442331-36442353 CCTGCTGCAGAGATGGGCCTGGG + Intergenic
1147065644 17:37921630-37921652 CCTGCTGCAGAGATGGGCCTGGG - Intergenic
1148434133 17:47668336-47668358 GATGCAGCAGTGATGGCTTTTGG + Exonic
1150889685 17:69133286-69133308 CAAGCTGCAGTCAGGGCACCTGG + Intronic
1151542616 17:74772316-74772338 CAGGCTCCAGTGCGGGCACTTGG + Intronic
1151561067 17:74869886-74869908 CGTGGAGCAGGGATGGCACTGGG - Intronic
1151677500 17:75606135-75606157 CATGCCGATGAGATGGCACTGGG - Intergenic
1155205115 18:23551929-23551951 CATGTGCCATTGATGGCACTGGG - Intronic
1156535288 18:37857891-37857913 AATTCTGCAGTGAAGCCACTGGG + Intergenic
1160641949 19:146519-146541 CATTCTGCATTGATCTCACTGGG - Intergenic
1163352949 19:16790772-16790794 CATGTTGAAGTGATACCACTTGG + Intronic
1166116932 19:40662209-40662231 CATCCCGCCGTGATGGCTCTAGG - Intergenic
1167405110 19:49301629-49301651 GCTGCTGCAGTGCTGGCAGTTGG - Intronic
1167492678 19:49801419-49801441 CACGCTGCACAGATGGAACTTGG - Exonic
925067646 2:940867-940889 AATGCTGAATTGCTGGCACTTGG + Intergenic
925750718 2:7088921-7088943 CATTCTGCAGAGATTGCCCTTGG + Intergenic
926651360 2:15349955-15349977 CCTCCTGCAGTGATGACTCTAGG - Intronic
927990179 2:27442181-27442203 GGTGCTGCAGTGGTGGCCCTGGG + Exonic
929664233 2:43821515-43821537 TCTGCGGCAGTGAGGGCACTGGG - Intronic
930036782 2:47090679-47090701 CATGCTGCTGTGAGGGAACGGGG - Intronic
931080033 2:58758594-58758616 AATGCTGCAGTCATGGCAGCAGG - Intergenic
932412334 2:71554801-71554823 GATGCTGCAGTCCTGGCACTTGG + Intronic
932739367 2:74280087-74280109 CATGTTGCAGTGTTGGAACTTGG - Intronic
932941791 2:76175293-76175315 CATGATGGAGTGATGGAAATAGG - Intergenic
934946513 2:98546398-98546420 GTTGCTGAGGTGATGGCACTGGG + Intronic
935478931 2:103561111-103561133 GATGCTTCAATGATGACACTTGG + Intergenic
935848059 2:107187912-107187934 CTTGCAGCAGTGTTGGCACAGGG - Intergenic
935956881 2:108385761-108385783 CAGACTGCAGTGATGGCAGGAGG - Intronic
936046362 2:109191183-109191205 AAGGATGCAGTGATGCCACTGGG + Intronic
937100355 2:119263824-119263846 CATGCTCCAGGGATGGCTCTGGG - Exonic
937362998 2:121241991-121242013 CATGAAGCTGGGATGGCACTGGG + Intronic
937991725 2:127666071-127666093 CCTGCTGCAGGGATGGGATTGGG + Intronic
941016261 2:160360584-160360606 CTTGGTGCAGAGCTGGCACTCGG - Intronic
943199186 2:184797205-184797227 AATACTCCACTGATGGCACTAGG - Intronic
943455622 2:188103384-188103406 CTGGCAGCAGTGTTGGCACTGGG - Intergenic
944260215 2:197668381-197668403 CATGCTGCTGTCCTGCCACTGGG + Intronic
945785561 2:214231614-214231636 AATGCTGGAGTAATGCCACTTGG - Intronic
946420269 2:219560860-219560882 CAGGGTGCAGTGATGGGACCGGG + Intronic
947252370 2:228122208-228122230 GATGCTGCACTGCTGGAACTAGG - Intronic
947673983 2:231961271-231961293 CGAGGTGCAGTGCTGGCACTGGG - Intronic
947693534 2:232162373-232162395 AATGCAGCAGTGATGGCAGCAGG - Intronic
948543288 2:238704940-238704962 CATGCTGCTGTGTTGGCCCTTGG - Intergenic
948811186 2:240479246-240479268 CCTGCTGCAGAGATGGCGGTGGG - Intergenic
1170555853 20:17514050-17514072 AAAGCTGCAGGGATGGCAGTGGG + Intronic
1172974327 20:38894887-38894909 CATGCTGCAGTGATGGCACGTGG - Intronic
1174429153 20:50455612-50455634 AGTGCTGCAGTGATGGTCCTTGG + Intergenic
1175214191 20:57381975-57381997 CATGCTCCAATGTTGGCATTGGG - Intergenic
1175226004 20:57444442-57444464 CATGCAGCATTGTAGGCACTGGG + Intergenic
1179823683 21:43952021-43952043 CATGCTGCAGCGAAGGACCTGGG + Intronic
1181100771 22:20537379-20537401 CATGGTACAGGGAGGGCACTTGG + Intronic
1181317291 22:21978934-21978956 ACTGCTGCAGTGATGGCCTTGGG + Intronic
1183958405 22:41396321-41396343 CATTCTGCAGAGATAGCCCTCGG - Exonic
1184646047 22:45896028-45896050 CATGCTGCAGATCTGGCAATGGG + Intergenic
949527002 3:4914972-4914994 CTTGCTGCTGTGTTGTCACTTGG + Intergenic
950505176 3:13390142-13390164 CACCATGCAGTCATGGCACTAGG - Intronic
951989417 3:28659440-28659462 CATTTTGCATTGGTGGCACTTGG + Intergenic
953875170 3:46662540-46662562 CTGGCTGCAGTGTTGGCACCTGG + Intergenic
953888464 3:46733402-46733424 CATGCTGCAGGGTAAGCACTTGG + Intronic
954873033 3:53782399-53782421 AATGCTGGTGTGGTGGCACTGGG - Intronic
955198181 3:56825176-56825198 GATGATGCAGTGAAGGCACAGGG + Intronic
955346408 3:58165042-58165064 CAGGCAGCAGTGCTGGCACTTGG + Intronic
955584608 3:60462790-60462812 CATGCTGCAGGGAGATCACTGGG + Intronic
962464872 3:135648949-135648971 CTTGCAGCAGTGTTGGCACAAGG + Intergenic
964988252 3:162771960-162771982 CAAGCAACAGTGATGGCAGTTGG + Intergenic
966326999 3:178767969-178767991 CAGGCTGCAGTGTTCGCATTTGG + Intronic
967319410 3:188180404-188180426 CATGCTGCCCTGATGGCCCAAGG + Intronic
967787518 3:193513636-193513658 CTTGCAGCACTCATGGCACTCGG - Intronic
968632200 4:1657530-1657552 CGTGCTGCAGTGATGAAAATGGG - Intronic
971819928 4:31539098-31539120 CCAGCTGCAGTGGTGGCAGTAGG + Intergenic
971893980 4:32565693-32565715 CAGTCTGCAAAGATGGCACTAGG - Intergenic
973863510 4:55088942-55088964 CATGCTGGACTGCTGGCACGGGG - Exonic
975749251 4:77506113-77506135 CATGCTGAAGGGGTAGCACTAGG - Intergenic
982856256 4:160385810-160385832 CCTGCTGCATTCATGGCACCTGG + Intergenic
984921319 4:184766714-184766736 CACGCTGAAGCGATGGCTCTTGG - Exonic
985357273 4:189135044-189135066 CTTGTTCCAGTGGTGGCACTAGG + Intergenic
988348445 5:30069997-30070019 CCTGCAGCAGTGTTGGCACAAGG - Intergenic
988681549 5:33488925-33488947 CATGCTGCAGTTTTGGCTCAGGG + Intergenic
989086786 5:37685097-37685119 CTGGCAGCAGTGTTGGCACTGGG + Intronic
991952482 5:71960046-71960068 TATGCTGCCATGATGGCAGTGGG + Intergenic
993380736 5:87204280-87204302 CCTTCTGCAGTGATCTCACTGGG + Intergenic
995984730 5:118156104-118156126 GAGGCTGCAGTGGTGGCATTAGG + Intergenic
996435016 5:123424281-123424303 AAAGCTGCAGAGATAGCACTAGG + Intergenic
997849181 5:137315593-137315615 CCTGCTGCACTGATGGCTCAAGG + Intronic
998596561 5:143536552-143536574 CATGCTGCAGTCATGACTCCTGG - Intergenic
999784099 5:154875427-154875449 CATGCAGCAGTGATGGCGCCAGG + Exonic
1001177935 5:169489947-169489969 AATGCAGCAGTGAAGCCACTAGG - Intergenic
1001590543 5:172861476-172861498 CAGGCTCCATTGATGGCACTGGG - Intronic
1001677691 5:173532078-173532100 CATGCTTCGGAGATGGCACTTGG - Intergenic
1002734910 5:181377965-181377987 CATTCTGCATTGATCTCACTGGG + Intergenic
1002749616 6:96157-96179 CATTCTGCATTGATCTCACTGGG - Intergenic
1002779063 6:352670-352692 CAGGCAGCAGTGTTGGCACCAGG + Intergenic
1004551587 6:16653287-16653309 CAGACTGCAGTGGTGACACTTGG - Intronic
1006439436 6:34043882-34043904 CACGCTGCTGTGACAGCACTGGG - Intronic
1007693504 6:43717704-43717726 CATTTTGCAGTGATGGTAGTGGG - Intergenic
1008664917 6:53706639-53706661 CATTCTGCAGTCATGGCTCTTGG - Intergenic
1008958810 6:57245006-57245028 CAGGCTGCAGGGATGGCTCCCGG + Intergenic
1010853344 6:80805155-80805177 CATTCTACTGTGATGGCATTGGG + Intergenic
1012597225 6:101054544-101054566 CCTTCTGCAGTGATCTCACTGGG + Intergenic
1015116811 6:129659049-129659071 CATGTTGCAGTGATGATATTTGG - Intronic
1015599257 6:134896457-134896479 CATCCTTCAGTGATAGCATTTGG - Intergenic
1016034057 6:139367655-139367677 CATGCTACAGTGAAGGAAATGGG - Intergenic
1016242909 6:141952993-141953015 CATGGAGCAGTGAGGGCCCTGGG - Intergenic
1019239172 6:170650282-170650304 CATTCTGCATTGATCTCACTGGG + Intergenic
1020399123 7:7754784-7754806 CATACTGCAGTGATGTCCTTTGG - Intronic
1020465824 7:8477675-8477697 CCTGCTGCAGGGATGGTGCTGGG + Intronic
1021083529 7:16391689-16391711 CATTCTGCAGTGATGGAAATAGG - Intronic
1023741869 7:43288229-43288251 CATGCTGCAGTGAAGGCTGTAGG + Intronic
1028450720 7:90979387-90979409 GATTATGGAGTGATGGCACTGGG - Intronic
1031613871 7:123857577-123857599 CATTCTGCATTGATCTCACTGGG + Intronic
1033238532 7:139657586-139657608 CATTGTGCAGAGATAGCACTGGG - Intronic
1035508600 8:156326-156348 CATTCTGCATTGATCTCACTGGG - Intergenic
1039399745 8:37259781-37259803 GATGCTTAAGTGATAGCACTAGG + Intergenic
1039887213 8:41661750-41661772 AAGGCAGCAGTGATGGCGCTGGG + Intronic
1039972367 8:42331121-42331143 CCTGCTGCACTGATGGCCCAGGG + Exonic
1041584060 8:59495487-59495509 CATTCTGCATTGATCTCACTGGG + Intergenic
1048959121 8:139561425-139561447 CCTGCCCCAGTGAGGGCACTGGG - Intergenic
1048992081 8:139766353-139766375 CATGCTGCAGTAATGCCCCCAGG + Intronic
1049454697 8:142680988-142681010 GAAGCTGCAGTGCTGGGACTGGG - Intronic
1051842664 9:21415976-21415998 CATCCTGTACTGATGGCACTAGG + Intronic
1052086669 9:24275785-24275807 CATGCTACAGTTCTGGCAGTAGG - Intergenic
1052139251 9:24958204-24958226 GATACTGCAGTAATGTCACTAGG + Intergenic
1052251704 9:26406323-26406345 CATGCCACAGTGGTGGCATTTGG + Intergenic
1056000884 9:82215640-82215662 CATTCTGCACTGATCTCACTGGG - Intergenic
1057170518 9:92960643-92960665 CATAGTGCAGTGCTGGCAATGGG + Intronic
1057218192 9:93241108-93241130 CAGGCAGCAGTGTTGGCCCTGGG - Intronic
1058898256 9:109418629-109418651 CTTTCTGCAGTGATGGGAATGGG + Intronic
1062120156 9:134829815-134829837 CAGGCTGCACTGAAGGCGCTCGG + Intronic
1062759378 9:138330573-138330595 CATTCTGCATTGATCTCACTGGG + Intergenic
1203599827 Un_KI270748v1:1345-1367 CATTCTGCATTGATCTCACTGGG + Intergenic
1186725719 X:12356456-12356478 CATCCTGAAGTGATGGTATTAGG + Intronic
1189141117 X:38607205-38607227 CATGCTCCAGAGACTGCACTGGG + Intronic
1190016593 X:46832736-46832758 CAAGCTCCAGAGATGGCTCTGGG - Intergenic
1190303251 X:49068202-49068224 CTAGCTGCTGTGATGGCACAGGG + Intronic
1191206627 X:57841824-57841846 CATTCTGCATTGATCTCACTGGG - Intergenic
1191888000 X:65909054-65909076 CATGCTGAAATGAAGACACTAGG - Intergenic
1192079414 X:68032834-68032856 GAGGCGGCAGTGATGGCATTTGG - Intergenic
1192905570 X:75547038-75547060 CCAGCTGCAGTGGTGGCAGTGGG + Intergenic
1193995648 X:88363889-88363911 CCTGCTGCAGTGGTGGCTGTGGG - Intergenic
1194330717 X:92580612-92580634 GAAGCTGCAGTGATGGCAGTTGG + Intronic
1194968486 X:100316991-100317013 TATGCTCCAGTTATGGCAGTAGG - Intronic
1198084529 X:133269563-133269585 CATTCTGCACTGATGGGACTTGG - Intergenic
1198948698 X:142044163-142044185 AATGCTACAGTGATTGCACTTGG - Intergenic
1199146876 X:144379311-144379333 TTGGCTGCAGTGTTGGCACTGGG + Intergenic
1200171283 X:154077133-154077155 CATGCAGCAGGAATGGAACTTGG + Intronic
1202057516 Y:20850306-20850328 TATGCTGCAGGGCTGCCACTGGG + Intergenic