ID: 924262417

View in Genome Browser
Species Human (GRCh38)
Location 1:242245843-242245865
Sequence CACCACTGGTTTGCATCTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924262411_924262417 7 Left 924262411 1:242245813-242245835 CCAGTACTGTGGCTTCTCACCAG 0: 1
1: 0
2: 0
3: 15
4: 161
Right 924262417 1:242245843-242245865 CACCACTGGTTTGCATCTTAAGG 0: 1
1: 0
2: 1
3: 9
4: 92
924262410_924262417 8 Left 924262410 1:242245812-242245834 CCCAGTACTGTGGCTTCTCACCA 0: 1
1: 1
2: 0
3: 20
4: 225
Right 924262417 1:242245843-242245865 CACCACTGGTTTGCATCTTAAGG 0: 1
1: 0
2: 1
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924262417 Original CRISPR CACCACTGGTTTGCATCTTA AGG Intronic
900232324 1:1566381-1566403 CACAAAAGGTTTGCATCTGAAGG + Intronic
902191323 1:14765274-14765296 CAGCAGTGGTTTGCAACTGAGGG - Intronic
912416393 1:109510587-109510609 CACCACTGGCCTTCATCTTGAGG - Intergenic
924262417 1:242245843-242245865 CACCACTGGTTTGCATCTTAAGG + Intronic
1067400745 10:45971689-45971711 CACCACCTGTTTGCTTCTTCAGG - Intergenic
1067869089 10:49941246-49941268 CACCACCTGTTTGCTTCTTCAGG - Intronic
1069904118 10:71722402-71722424 CAGCCCTGGTTTGCATCCTTGGG - Intronic
1072737844 10:97891190-97891212 CACCACTGTTTGGAATATTAAGG - Intronic
1082765020 11:57160635-57160657 GGCCACTGGTTTGCAACTTCTGG - Intergenic
1083914894 11:65735483-65735505 CACCAGTGGTTTGCAGCTCTCGG + Intergenic
1086079752 11:82890807-82890829 CACTACTGGTTACCTTCTTACGG + Intronic
1089901602 11:121992427-121992449 CACCACAGGTTTTCTTCTGAAGG - Intergenic
1091022331 11:132111861-132111883 CACCACTAGTTTGAATTTTCTGG + Intronic
1093554358 12:20453059-20453081 CACCACTGTTTTGAATCTGTAGG + Intronic
1094454868 12:30620902-30620924 CACCACTGGTTTGAATTAGAAGG + Intergenic
1103975088 12:124697185-124697207 CCCCACTGCTTTGCCTCTTTTGG - Intergenic
1104387360 12:128362771-128362793 CTGCACTGTTTTGCATTTTATGG - Intronic
1105464803 13:20629242-20629264 CACCACTGTTTTGAATCTCTAGG - Intronic
1106831512 13:33588535-33588557 CACCACTGGTTTTCTCCTTCAGG + Intergenic
1110327457 13:74233349-74233371 CACCACAGGTATGCATTTCAGGG - Intergenic
1111068354 13:83128420-83128442 CAACACTCTTTTTCATCTTAAGG - Intergenic
1112058317 13:95712028-95712050 CACCACTGGTTTCTATTATAAGG + Intronic
1119987757 14:79158555-79158577 CATCACTGGTTTTCATATTGAGG + Intronic
1120551385 14:85877137-85877159 CACCATTGATTTGCATATTTTGG - Intergenic
1120568328 14:86086540-86086562 CAACACTGTCTTGCATTTTAAGG - Intergenic
1121658363 14:95615415-95615437 CACCATTTGTATACATCTTAGGG - Intergenic
1121822578 14:96983292-96983314 TAGCACTGGTTTGCTTCTTTAGG - Intergenic
1124876639 15:33601145-33601167 CACCGATGGTTTGCATCGTTTGG + Intronic
1125523415 15:40360565-40360587 CACCACTGGTTTGCTTCTGCTGG - Intronic
1130325278 15:82874645-82874667 CACCACTGTGTGGCATTTTAAGG + Intronic
1136013238 16:27378422-27378444 CACCACTGGTTGTGATTTTAGGG + Intergenic
1136777455 16:32879425-32879447 CCCCGCTGGTTTGCATGGTAAGG - Intergenic
1136893169 16:33982089-33982111 CCCCGCTGGTTTGCATGGTAAGG + Intergenic
1139466513 16:67156798-67156820 CACCACTGGTTGGCATACTTGGG + Intronic
1203079868 16_KI270728v1_random:1141534-1141556 CCCCGCTGGTTTGCATGGTAAGG - Intergenic
1144424248 17:15126544-15126566 CACAACTGGGTTGGATCTTAAGG + Intergenic
1148862412 17:50611500-50611522 CACCACTGCTTAGCATCATGGGG - Intronic
1149137902 17:53392031-53392053 CATCAATGGTGTGAATCTTATGG + Intergenic
1153563786 18:6398847-6398869 CACCACTGCTTCCCATCCTAAGG + Intronic
1157158616 18:45291665-45291687 CACCACTCGTTGGCATGTTAGGG + Intronic
1157692439 18:49694653-49694675 GACCACTCCTTTGGATCTTAAGG - Intergenic
1158062577 18:53363905-53363927 CACCTCTGGTATGTATCTCATGG - Intronic
1158914094 18:62102581-62102603 CATCACTGGGCTGCCTCTTATGG + Intronic
1161953474 19:7480299-7480321 GACCTCTGGTTTGTATTTTAGGG - Intronic
1162563720 19:11433427-11433449 AACCACTGGTTTACACCTTATGG + Intronic
1165393679 19:35552306-35552328 CACCACTGATTTACCTCCTAGGG - Intronic
1166443857 19:42841167-42841189 CACCACTGTATTCCATCCTAGGG + Intronic
1166451299 19:42903849-42903871 CACCACTGTATTCCATCCTAGGG + Intronic
1167403269 19:49287055-49287077 CACCACTGGTTTTTATCCCAGGG - Intergenic
925240693 2:2324303-2324325 CACCCCTGCCTTCCATCTTAGGG + Intronic
935542137 2:104361169-104361191 CACCACTCCTTGGCATCTTTTGG - Intergenic
936780161 2:116022874-116022896 AGCCACTGGTTTGGATATTATGG - Intergenic
938192658 2:129297643-129297665 CACAACTGTGTTGCTTCTTAAGG - Intergenic
938753134 2:134354435-134354457 CACCATTGGGATGCATCTTGAGG + Intronic
938944619 2:136200452-136200474 CACCACTGGTTTCAGTGTTAGGG + Intergenic
938958329 2:136318993-136319015 CCCCACTAATGTGCATCTTATGG + Intergenic
942745592 2:179228455-179228477 CACCACAGGCTTGTATCTTAAGG - Intronic
945333483 2:208565438-208565460 AAGCACTGTTTTGCATGTTAGGG + Intronic
1169566238 20:6856455-6856477 CACGACTGGGTTCCATCTTGTGG - Intergenic
1170593391 20:17787835-17787857 CACCACTGATGGGCATTTTACGG - Intergenic
1171349401 20:24491162-24491184 GCCAACTGGTTAGCATCTTAAGG - Intronic
1175262712 20:57684736-57684758 CACCAGAGGTTGGCTTCTTAAGG - Intronic
1183803892 22:40192227-40192249 CTCCACTGATTTTCATGTTAAGG + Intronic
1184870317 22:47233655-47233677 CACCACTGCTTTCCATCATATGG - Intergenic
950207744 3:11093428-11093450 CACTACTGGCCTGCATCTCAAGG - Intergenic
954030636 3:47817638-47817660 CACCACGTGTCTGCTTCTTATGG - Intronic
961373204 3:126445135-126445157 CACCACTAATTTGCATCAGAAGG + Intronic
967344864 3:188443709-188443731 GAACACTTGTTTCCATCTTAAGG - Intronic
968662566 4:1804861-1804883 CACCACTGGTGCGCATCGCAAGG + Exonic
973585354 4:52384770-52384792 CACCACTGGATGTCATCTGAGGG - Intergenic
976842437 4:89446963-89446985 CACCACTGATTTGCCTCTGTGGG + Intergenic
980488969 4:133499972-133499994 CACCACTGTTTTGTATTCTATGG + Intergenic
980617533 4:135250488-135250510 CTCCAGTGGTTAGCTTCTTAGGG + Intergenic
981701469 4:147611505-147611527 CACCACAGGCTAGCATCTAATGG + Intergenic
983753872 4:171309899-171309921 CAACACTGGTTTGTAACTTAGGG - Intergenic
984866788 4:184287792-184287814 CACCACGTGTTTGAATCTTTAGG - Intergenic
989353913 5:40519405-40519427 CAAAACTGGTTTGCATTTTAGGG - Intergenic
992140454 5:73791432-73791454 CACCACTGGCTTACATCTACAGG - Intronic
992151044 5:73903431-73903453 ACTCACTGGTTTGCATCCTAGGG + Intronic
994534411 5:101009299-101009321 CACCACTGATTTCCATGTTCTGG - Intergenic
997460371 5:134047650-134047672 CCCCAATGGGTTGCAGCTTATGG - Intergenic
998304559 5:141060767-141060789 TACCATTGGTTTGGCTCTTATGG + Intergenic
1000200947 5:159010498-159010520 CATGACTAGTTTGCATCTTTTGG + Intronic
1007013301 6:38438271-38438293 TACTACTGGATTGCAGCTTATGG + Intronic
1008938407 6:57018364-57018386 CATGAGTGCTTTGCATCTTAGGG - Intronic
1011088436 6:83569433-83569455 AACAACTGTTTTGCATCTTTAGG - Intronic
1012309675 6:97707087-97707109 CACATCTGCTTTGCATCTTAGGG - Intergenic
1018981342 6:168604005-168604027 CTCCACTGCTGTGCCTCTTAGGG - Intronic
1033019259 7:137706241-137706263 CCCCAGTGGTTTGTATCTTTGGG - Intronic
1033629852 7:143146946-143146968 CCCTCCTGGTTTGCATCTTCAGG - Intergenic
1039028796 8:33287068-33287090 CACCAATGTTTTGTCTCTTAAGG + Intergenic
1039291223 8:36096213-36096235 CAATACTGGTTTGCATCGTGGGG - Intergenic
1042443828 8:68860661-68860683 CACAACTGGTTTGGATCTTAGGG - Intergenic
1043984993 8:86683540-86683562 TACCATCTGTTTGCATCTTAAGG - Intronic
1047435328 8:124831156-124831178 CACCACTGGCTCTCATCTTGGGG - Intergenic
1051065894 9:13102719-13102741 CACCAATTTTTTGCCTCTTAAGG + Intergenic
1051507659 9:17843742-17843764 CACCACTGGTTTTGACCTTGAGG + Intergenic
1056104778 9:83336404-83336426 GTCCACTGGTTTCCATCTAAAGG - Intronic
1185859115 X:3561259-3561281 CACCAATTCTTTGCATTTTAAGG + Intergenic
1186127454 X:6429418-6429440 CAGCTCTGTTTTGCATCATAGGG - Intergenic
1189417100 X:40824970-40824992 CACCTCTGCTATGCATTTTAAGG - Intergenic
1201490392 Y:14535155-14535177 CAATACTGGTATGCATGTTAGGG - Intronic
1201609674 Y:15826911-15826933 CAACTCTGTTTTGCATCATAGGG - Intergenic