ID: 924263828

View in Genome Browser
Species Human (GRCh38)
Location 1:242260056-242260078
Sequence AGAGAATTGTTGGCCAGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2837
Summary {0: 2, 1: 1, 2: 44, 3: 411, 4: 2379}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924263828 Original CRISPR AGAGAATTGTTGGCCAGGTG GGG Intronic
Too many off-targets to display for this crispr