ID: 924268612

View in Genome Browser
Species Human (GRCh38)
Location 1:242308934-242308956
Sequence GTGTGGGAGGGGAGGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4297
Summary {0: 2, 1: 2, 2: 20, 3: 263, 4: 4010}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924268599_924268612 22 Left 924268599 1:242308889-242308911 CCATGTATCCTCTTCTGCACTCG No data
Right 924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG 0: 2
1: 2
2: 20
3: 263
4: 4010
924268600_924268612 14 Left 924268600 1:242308897-242308919 CCTCTTCTGCACTCGTTATTTTG 0: 1
1: 0
2: 0
3: 18
4: 180
Right 924268612 1:242308934-242308956 GTGTGGGAGGGGAGGATGGAAGG 0: 2
1: 2
2: 20
3: 263
4: 4010

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924268612 Original CRISPR GTGTGGGAGGGGAGGATGGA AGG Intronic
Too many off-targets to display for this crispr