ID: 924270789

View in Genome Browser
Species Human (GRCh38)
Location 1:242330402-242330424
Sequence GTGGCCCTTACTTGGAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 148}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924270785_924270789 9 Left 924270785 1:242330370-242330392 CCTTTTCACATCAGCAAATCTTG 0: 1
1: 0
2: 2
3: 76
4: 379
Right 924270789 1:242330402-242330424 GTGGCCCTTACTTGGAAGCCTGG 0: 1
1: 1
2: 0
3: 7
4: 148
924270784_924270789 30 Left 924270784 1:242330349-242330371 CCATTCTGTGACAACATTGAGCC 0: 1
1: 0
2: 1
3: 7
4: 108
Right 924270789 1:242330402-242330424 GTGGCCCTTACTTGGAAGCCTGG 0: 1
1: 1
2: 0
3: 7
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924270789 Original CRISPR GTGGCCCTTACTTGGAAGCC TGG Intronic
902839541 1:19066329-19066351 GGTGCCCTTGCCTGGAAGCCAGG - Intergenic
905309041 1:37036934-37036956 CTGGCCCCAACTTGGAAGGCAGG - Intergenic
906455375 1:45991995-45992017 GTGGCTCATACTTGTAATCCTGG - Intronic
912956746 1:114159289-114159311 TTGGCCCTTTCCTGGAAGCAGGG - Intergenic
913066755 1:115263060-115263082 GTGTCCCTTGCTTGAAAGACAGG + Intergenic
913694203 1:121308505-121308527 GTGGCTCATACTTGTGAGCCTGG + Intronic
918039601 1:180905501-180905523 GTGGCTCATACTTGTAATCCTGG - Intergenic
919325530 1:196101653-196101675 GTGGACTTTACTTGGAGTCCGGG + Intergenic
920352332 1:205345467-205345489 GTGGCTCATACTTGTAATCCAGG + Intronic
920481530 1:206326892-206326914 GTGGCTCATACTTGTGAGCCTGG + Intronic
923365368 1:233255244-233255266 GTGGTCCTAAGTTGGAAGCAGGG - Intronic
924270789 1:242330402-242330424 GTGGCCCTTACTTGGAAGCCTGG + Intronic
1065915328 10:30350233-30350255 GTGGCCCTTGCTCGGGTGCCTGG + Intronic
1066714157 10:38268456-38268478 GTGGCCCTTACTTGGAATCCTGG - Intergenic
1071714652 10:88083372-88083394 GTGGCCCATATTTGGAAGGAAGG - Intergenic
1073234201 10:101999814-101999836 GTGGCCCATACCTGTAATCCCGG + Intronic
1073430902 10:103486263-103486285 GTGGCCTTTACTTGGCAGGATGG - Intergenic
1076140966 10:128078260-128078282 TTGGGCCTGACTTGGGAGCCAGG - Intronic
1078798534 11:14619090-14619112 ATGGCCCTTACATTTAAGCCAGG + Intronic
1082980360 11:59115217-59115239 CTGGCCCCTACTTCTAAGCCTGG - Intronic
1084636724 11:70398149-70398171 GTGGCCCTTTCTTGGAGGGGAGG + Intergenic
1085663465 11:78391577-78391599 GTGGCCTTTACATGGAGCCCAGG - Intronic
1087982265 11:104630112-104630134 GTGGCCCTTGCTTCTAAGTCTGG - Intergenic
1088744841 11:112796649-112796671 GTGGCCCTTGCTGGGCAGTCTGG - Intergenic
1091269037 11:134292798-134292820 GTGGCTCTTCCAAGGAAGCCTGG + Intronic
1093077091 12:14769871-14769893 AGGGCCTTTACTCGGAAGCCAGG + Intronic
1095332284 12:40980962-40980984 GTGGCACTTACTTGGAGCCGTGG + Exonic
1098509649 12:71296749-71296771 ATGGCCCCTAATTGGGAGCCAGG - Intronic
1100320096 12:93482852-93482874 GTGGCTCATGCTTGTAAGCCCGG - Intronic
1103478060 12:121232907-121232929 GTGCCCCTTCCTGAGAAGCCTGG - Intronic
1103713435 12:122929488-122929510 ATGGCCCTTCCTTAGTAGCCTGG - Exonic
1107709990 13:43142164-43142186 GTGGCCCTTGCCTTGAAGACTGG + Intergenic
1108171656 13:47748190-47748212 GTGTCCCTGCCTTAGAAGCCAGG + Intergenic
1109257675 13:60102950-60102972 GCAGCCCTTACCTGGAAACCAGG + Intronic
1113063750 13:106353802-106353824 GTGGCCTTTACATGGAGGCCTGG + Intergenic
1114080533 14:19199102-19199124 GTGGTCTCTGCTTGGAAGCCGGG + Intergenic
1118727318 14:68638387-68638409 TTGGAGCTTGCTTGGAAGCCTGG - Intronic
1120212198 14:81644337-81644359 GTGGCCCATACCTGTAATCCTGG + Intergenic
1122765997 14:104070576-104070598 TTGGCCCTTGATTGGCAGCCGGG - Intergenic
1123017674 14:105383135-105383157 CTGGCCTGTCCTTGGAAGCCTGG + Intronic
1124210190 15:27756882-27756904 GTGGCTCTCACTTGGGAGCACGG - Intronic
1124395344 15:29295726-29295748 GTGGCCGTCACTTAGTAGCCAGG - Intronic
1124432398 15:29618836-29618858 TTGGCCCTTTCTTGAGAGCCAGG - Intergenic
1125282476 15:38057417-38057439 GTGGCTCATACTTGCAATCCTGG - Intergenic
1126575633 15:50193589-50193611 TGGGCCCTTACTTGTAAGCAAGG + Intronic
1126743963 15:51806457-51806479 GTGGCCCTTGCTTGGTAAACTGG - Exonic
1127757277 15:62104874-62104896 GTGGCTCTTACTGGCAATCCAGG - Intergenic
1128258999 15:66218688-66218710 GTGGCCCCTAGTGGGAAGCCAGG + Intronic
1129196346 15:73969443-73969465 CTGGCCCTAAGTTGGAAGCTGGG + Intergenic
1132870579 16:2114072-2114094 GCTGCCCTCACTGGGAAGCCAGG + Intronic
1133981349 16:10635380-10635402 GTGCCTCTTTCATGGAAGCCTGG + Intronic
1133983303 16:10649702-10649724 GTGGCTCATACTTGTAATCCCGG - Intronic
1134247122 16:12548266-12548288 GTGGACCTGACTGGGAAGGCTGG + Intronic
1134521953 16:14922832-14922854 GCTGCCCTCACTGGGAAGCCAGG - Intronic
1134709623 16:16321483-16321505 GCCGCCCTCACTGGGAAGCCAGG - Intergenic
1134716836 16:16361512-16361534 GCTGCCCTCACTGGGAAGCCAGG - Intergenic
1134949980 16:18347162-18347184 GCTGCCCTCACTGGGAAGCCAGG + Intergenic
1134957916 16:18390647-18390669 GCTGCCCTCACTGGGAAGCCAGG + Intergenic
1138371895 16:56533645-56533667 GTGGCCCTTTCATGGGATCCTGG + Intergenic
1139895551 16:70285580-70285602 GTGGCACTTACCTGTAATCCAGG - Intronic
1140349384 16:74247568-74247590 GTGGCCCTTTCTTGAAGGTCTGG + Intergenic
1144058382 17:11560523-11560545 GTGGCCATCCCTTGGAAGGCAGG + Exonic
1144201972 17:12949719-12949741 GGGGTACTCACTTGGAAGCCTGG - Exonic
1144583278 17:16472257-16472279 GTGGCACCTCCTTGGATGCCAGG - Intronic
1150214467 17:63459013-63459035 CTGGGCCTTCCTTTGAAGCCAGG - Intergenic
1150221412 17:63497630-63497652 GTGTCCCTCACAGGGAAGCCAGG + Intronic
1150719615 17:67603132-67603154 GTGGCTCTGACTTTGAAACCTGG - Intronic
1152041487 17:77906585-77906607 GTGACCCTTGCCTGGTAGCCTGG - Intergenic
1152109882 17:78352162-78352184 GTGGCCCTAACTTAGAATCCTGG - Intergenic
1153300937 18:3591555-3591577 GTGCCACCTACTTGGAAGGCTGG - Intronic
1154290650 18:13103068-13103090 GTGGCCTCTACTTTGAAGACAGG - Intronic
1155085419 18:22453383-22453405 ATGGCTCTTACATGGAATCCTGG + Intergenic
1156514100 18:37665488-37665510 GAGGCCCTCCCTTGGGAGCCAGG + Intergenic
1157547198 18:48554855-48554877 CAGGCCATTACTTGGCAGCCCGG + Intronic
1157848195 18:51023741-51023763 GAGGCCCTAACTTGGGAGCATGG + Intronic
1160072826 18:75643385-75643407 GTGGCCAGTTCTTGGAGGCCTGG - Intergenic
1160823732 19:1069728-1069750 CTGGCGCTTCCTTGGAGGCCTGG + Intronic
1162393633 19:10404073-10404095 GTGGCCCTGCCTTGGGAGCTGGG + Intronic
1162471205 19:10872581-10872603 TTAGCTCTTACTTCGAAGCCCGG - Intronic
1163582972 19:18149285-18149307 GTGGCCCAAGCTTGGCAGCCAGG - Exonic
1165106336 19:33471739-33471761 GTGGCTCTCACTTGTAATCCCGG + Intronic
1165391298 19:35540448-35540470 GTGTCCCTAATTTGGAAGGCAGG + Intronic
1165438154 19:35808080-35808102 GAGGCACTTACTTGCAAGTCAGG - Intronic
1166784254 19:45358286-45358308 GTGGCTCATACTTGTAATCCTGG - Intronic
1167836426 19:52075552-52075574 GTTGCCCTTCCTTTGAAGCTGGG - Intronic
1168725285 19:58577911-58577933 GTGGCTTTTACTTGAAGGCCTGG + Intergenic
927648951 2:24899213-24899235 GTGGCCCAGAGTTGGATGCCTGG - Intronic
929553531 2:42909275-42909297 TTGTCCCATAGTTGGAAGCCTGG + Intergenic
931371242 2:61665029-61665051 ATGGACCTTATTTGGATGCCTGG + Intergenic
931666669 2:64614599-64614621 GTGGCTCATACTTGTAATCCTGG + Intergenic
935648746 2:105363955-105363977 GGAGTCCTTACTTAGAAGCCTGG + Intronic
939845746 2:147244364-147244386 GTGGCCATTACTGGGAACCTGGG - Intergenic
945095666 2:206216548-206216570 GTGGCCCATACCTGTAATCCCGG - Intronic
948299314 2:236890098-236890120 GTGGCCCTTTCTCTCAAGCCAGG - Intergenic
1168830660 20:843705-843727 TTGGCCCTTCCTTGGAAACAGGG + Intronic
1172270807 20:33654793-33654815 GTGGCCCTGACTTGGGGGCTGGG + Intergenic
1172670322 20:36630509-36630531 GTGGGCCTTTCTTGGGGGCCTGG + Intronic
1173318249 20:41964132-41964154 GTGGCTCATGCTTGGAATCCCGG - Intergenic
1175298695 20:57927636-57927658 GTGACCCTTCCTTTGAAGCTGGG - Intergenic
1175578977 20:60084437-60084459 GTCACACTTACTTGGAAGACTGG - Intergenic
1175878550 20:62243298-62243320 GTGAGACTTACTTGGAAGACGGG - Intronic
1177274062 21:18884061-18884083 GTGGCAGTTATTTTGAAGCCGGG - Intergenic
1179877665 21:44279030-44279052 GTGGCTCATACTTGTAATCCCGG - Intergenic
1180500246 22:15923582-15923604 GTGGTCTCTGCTTGGAAGCCGGG - Intergenic
1182035474 22:27195191-27195213 CTGGCTCTTTCTGGGAAGCCTGG - Intergenic
1185363332 22:50422629-50422651 GTGCCCCCAACTTGGAGGCCAGG - Intronic
949102820 3:166312-166334 CTAGTCCTTATTTGGAAGCCTGG + Intergenic
949416429 3:3819709-3819731 GTGGCCCTTTTTTGGAAACAGGG - Intronic
954647315 3:52139561-52139583 GTGGCCCTAATTGGGAGGCCAGG - Intronic
960195531 3:114762701-114762723 GTGGCACCTCCTGGGAAGCCAGG + Intronic
965460037 3:168951297-168951319 CTGGCCCTAACTTTGAAGCAAGG - Intergenic
969435395 4:7186340-7186362 GTGGCAGGCACTTGGAAGCCAGG - Intergenic
972599819 4:40562259-40562281 GTGGTCCTCTTTTGGAAGCCTGG + Intronic
974309287 4:60183837-60183859 GTGGCACATACCTGGAATCCCGG - Intergenic
977970295 4:103205514-103205536 GTGGCCCTTAACTGCAAGGCAGG - Intergenic
986093802 5:4536590-4536612 GTGGCCCTCACCTGCAGGCCTGG + Intergenic
989156828 5:38352258-38352280 GTGGCCCTGTCTTGGAAACCTGG + Exonic
989998342 5:50862506-50862528 TTGCCACTTATTTGGAAGCCAGG + Intergenic
990026589 5:51198912-51198934 GTGACCCTCACTTGGATGCCTGG - Intergenic
995603597 5:113826325-113826347 GTGGCACTTACTTAGTAGCTGGG + Intergenic
998353687 5:141517126-141517148 GAGGCCCTTACTTTGAAGAAAGG + Intronic
1001749854 5:174120588-174120610 GAGGCCCTGTGTTGGAAGCCAGG + Intronic
1006990634 6:38212136-38212158 GTGGCCCTCCCTTGGTGGCCAGG + Intronic
1016710575 6:147166602-147166624 TTGGTCCTAAGTTGGAAGCCAGG - Intergenic
1017309390 6:152958368-152958390 GTGGCACGTACTTGTAATCCTGG - Intergenic
1017915977 6:158831939-158831961 GTGTCCTCTACATGGAAGCCAGG - Intergenic
1018041919 6:159932256-159932278 GTGCCCCTTCCTCAGAAGCCTGG + Intergenic
1018588728 6:165392079-165392101 AAGTCCCTTACTTGAAAGCCAGG - Intronic
1018702698 6:166439747-166439769 TTGGTCCTGACTTGGAAGCAGGG + Intronic
1018795471 6:167181907-167181929 GGGGCCCTGACCTGGAGGCCAGG + Exonic
1018820851 6:167373156-167373178 GGGGCCCTGACCTGGAGGCCAGG - Exonic
1019378219 7:707586-707608 GTTGACCTTACTTGGAGGCAGGG + Intronic
1024345815 7:48311774-48311796 GTGGCCCTCACATGGAGGTCGGG - Intronic
1025193205 7:56912006-56912028 GTGGGCCTTATATGGAAGGCTGG + Intergenic
1025678737 7:63664918-63664940 GTGGGCCTTATATGGAAGGCTGG - Intergenic
1026036146 7:66831964-66831986 GTGGCTCATACTTGTAATCCCGG - Intergenic
1026530413 7:71192527-71192549 GTGGCACATACTTGTAATCCCGG - Intronic
1028047235 7:86137421-86137443 GTCCCCCATACTTTGAAGCCAGG - Intergenic
1029660574 7:101958327-101958349 CTGGGCCCTACTTGGGAGCCAGG + Intronic
1031886498 7:127251200-127251222 GTGGCCCAAACTGTGAAGCCTGG - Intronic
1034222273 7:149455713-149455735 GGGTCCCTTCCTGGGAAGCCAGG + Exonic
1034450278 7:151133507-151133529 GGGGCCCTGACTTGAAAGCAGGG + Intronic
1041208631 8:55523985-55524007 GTGGGCCTCACTTGAAAGACAGG - Exonic
1044321151 8:90803163-90803185 GTGGCCCATGCTTGTAATCCCGG - Intronic
1047995012 8:130326340-130326362 GTGGCCCTTACATTGCAGGCAGG - Intronic
1049426725 8:142541108-142541130 AGGGCCCTTCCTGGGAAGCCTGG - Intronic
1057146441 9:92762503-92762525 GTGGCCAGTACATGGAAGCCAGG + Intronic
1057333765 9:94140780-94140802 GTGGCACATTCTTGGAGGCCTGG - Intergenic
1057384520 9:94595387-94595409 GTGCCCCTTGCTTGGCATCCTGG + Intergenic
1059429130 9:114239656-114239678 ATGGCCCTCACTGGGAAGCAGGG + Intronic
1060808488 9:126594487-126594509 GTAGACCTGACTTGGAAACCAGG + Intergenic
1061346256 9:130028036-130028058 GTGGCCCATACCTGGAATCCTGG - Intronic
1186750050 X:12612503-12612525 ATGGCCTTTACTTTGAAGTCTGG - Intronic
1188727118 X:33599392-33599414 GTGGTCTTTATTTGGAAGCTTGG - Intergenic
1197908020 X:131447504-131447526 GTGGTCCTTAATTGGCAACCTGG - Intergenic
1198744361 X:139874611-139874633 GTGGGCCTTAATTTGAATCCAGG + Intronic
1199574723 X:149302445-149302467 GAGGCCTTTCCTTGAAAGCCAGG + Intergenic