ID: 924270914

View in Genome Browser
Species Human (GRCh38)
Location 1:242331820-242331842
Sequence TATTATGCACAGGGCACTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 2, 1: 0, 2: 0, 3: 8, 4: 104}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924270914_924270918 0 Left 924270914 1:242331820-242331842 CCTAGAGTGCCCTGTGCATAATA 0: 2
1: 0
2: 0
3: 8
4: 104
Right 924270918 1:242331843-242331865 TTCTTAATAGATTAAAACTAGGG 0: 1
1: 1
2: 2
3: 32
4: 382
924270914_924270917 -1 Left 924270914 1:242331820-242331842 CCTAGAGTGCCCTGTGCATAATA 0: 2
1: 0
2: 0
3: 8
4: 104
Right 924270917 1:242331842-242331864 ATTCTTAATAGATTAAAACTAGG 0: 1
1: 1
2: 3
3: 43
4: 469
924270914_924270919 3 Left 924270914 1:242331820-242331842 CCTAGAGTGCCCTGTGCATAATA 0: 2
1: 0
2: 0
3: 8
4: 104
Right 924270919 1:242331846-242331868 TTAATAGATTAAAACTAGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924270914 Original CRISPR TATTATGCACAGGGCACTCT AGG (reversed) Intronic
902535166 1:17115546-17115568 TATTAGGGACAGGGCAGCCTCGG - Intronic
906666041 1:47622777-47622799 TATTCTGCCCAGGACGCTCTAGG - Intergenic
907624780 1:56018891-56018913 TATTCTCAACTGGGCACTCTTGG - Intergenic
924270914 1:242331820-242331842 TATTATGCACAGGGCACTCTAGG - Intronic
924948447 1:248861736-248861758 GAATATGCACAGGACACACTGGG - Intergenic
1063802301 10:9594160-9594182 TATTAGGCAGAGGGGACTTTGGG - Intergenic
1066119431 10:32270175-32270197 TTTTTTGCACAGGGAATTCTGGG - Intronic
1066714036 10:38267038-38267060 TATTATGCACAGGGCACTCTAGG + Intergenic
1070896144 10:79984024-79984046 TATTAATCACAGTGCTCTCTTGG + Intergenic
1071133591 10:82426140-82426162 TCTTAAGAACAGAGCACTCTGGG + Intronic
1073649853 10:105346822-105346844 TATTAGGCAAAGGGCACTTGAGG - Intergenic
1079659663 11:23021997-23022019 TCTCATCCACAGGGCTCTCTAGG + Intergenic
1086545514 11:87963287-87963309 AATTTTGCTCAGGCCACTCTGGG - Intergenic
1087022079 11:93613413-93613435 TATATGGCACAGGCCACTCTGGG + Intergenic
1088117227 11:106326541-106326563 GATACTGCACAGGGCACCCTGGG + Intergenic
1089906583 11:122046386-122046408 GAATATGCACAGTGTACTCTGGG + Intergenic
1091555419 12:1569830-1569852 TCCTTTGCACAGGGGACTCTGGG - Intronic
1092735384 12:11577697-11577719 TATTATGTACTTGGCCCTCTGGG - Intergenic
1094243612 12:28260081-28260103 TATTATGCATTAGGCACTATGGG + Intronic
1097896540 12:64829211-64829233 TATTATGAACGGGCTACTCTGGG + Intronic
1097901335 12:64876456-64876478 TCTTATGCACAGGACACACTTGG + Intronic
1100406050 12:94273707-94273729 TATTGTGTGCAGGGCACTGTAGG - Intronic
1101674231 12:106903187-106903209 AATAAGGCACAGGGCACTTTTGG + Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1109776091 13:67042689-67042711 TATTATGCACCAGGCACAATGGG + Intronic
1112992688 13:105533514-105533536 TATCCTGCACAGGTCACTCTGGG + Intergenic
1114425017 14:22614279-22614301 TAGTATAAACAGGGGACTCTGGG - Intergenic
1117638076 14:57768422-57768444 TGTTATTCACAGGACACTTTTGG - Intronic
1118016762 14:61668636-61668658 AAGTATCCACAAGGCACTCTGGG - Intergenic
1118042665 14:61934478-61934500 TGTTATGCAAAGGAAACTCTGGG + Intergenic
1118367018 14:65104509-65104531 TGCTATGAACAGAGCACTCTAGG + Intergenic
1119545568 14:75469199-75469221 GGTTAGGCACAGGGCACGCTGGG - Intronic
1122932773 14:104942331-104942353 CCTCATGCACAGGGCCCTCTGGG + Exonic
1123541226 15:21293860-21293882 TATTAGGCACAAGGCCCTCAAGG + Intergenic
1125034990 15:35112926-35112948 AATTAAGCACAGGGCACTTGAGG - Intergenic
1125793171 15:42385316-42385338 TATTATGCCCAGGGCTCTGCAGG - Intronic
1126550895 15:49928216-49928238 TGTTATGAACAAGGCATTCTGGG + Intronic
1130638649 15:85649423-85649445 TATTTTGCATAGCACACTCTGGG - Intronic
1131346187 15:91650817-91650839 TATTATGATCAGGGCACAATGGG + Intergenic
1202949539 15_KI270727v1_random:21001-21023 TATTAGGCACAAGGCCCTCAAGG + Intergenic
1134302063 16:13000710-13000732 TACCATGCACCAGGCACTCTGGG - Intronic
1140991442 16:80216534-80216556 AAGTATGCACTGGGCACTTTAGG - Intergenic
1142732620 17:1871489-1871511 TTTTGTTCTCAGGGCACTCTAGG + Intronic
1143054614 17:4153577-4153599 TTTTATGGACAGAGAACTCTAGG + Intronic
1148729488 17:49823658-49823680 TATTATGCACAGGGTCCATTGGG - Intronic
1149297114 17:55271065-55271087 TATTATGCCCAGGGGACATTTGG - Intronic
1149406470 17:56356957-56356979 AATTATGCACAGGGGGCTTTGGG - Intronic
1150054205 17:61996875-61996897 TATTATGTACCAGGTACTCTAGG - Intronic
1160907679 19:1459410-1459432 TCGTGTGCACAGGGCACGCTGGG + Intronic
1163838009 19:19587880-19587902 GATTCTTCACAGAGCACTCTGGG - Intronic
1165106253 19:33471258-33471280 AATTATCCGTAGGGCACTCTGGG + Intronic
925024764 2:599048-599070 TATTGGGCAGAGGGCAGTCTGGG - Intergenic
928413724 2:31073988-31074010 TACTATGCACAGAGAACTCAGGG - Intronic
928453912 2:31402447-31402469 TGCTGTGCACAGGGCACTATGGG + Intronic
929935188 2:46289710-46289732 TTTCATACACAGTGCACTCTGGG + Intergenic
930733123 2:54747370-54747392 TATTATGCAGAAAGCACACTTGG - Intronic
940239211 2:151544985-151545007 TATTATGGCCAAGGCACTATGGG + Intronic
940621516 2:156119886-156119908 TATTATGCACAATTCACTTTTGG - Intergenic
945759339 2:213894142-213894164 TATTATACAGTGGGCACTTTTGG - Intronic
946084652 2:217158274-217158296 TATTACGCCCAGGACACACTGGG - Intergenic
948403254 2:237699860-237699882 TACCAGGCACAGGGCACTCTGGG - Intronic
949009508 2:241670543-241670565 GACCATGCACAGGGCACCCTCGG + Intronic
1168981342 20:2006630-2006652 AACTATGCGCTGGGCACTCTCGG + Intergenic
1169366373 20:4996100-4996122 GATTATGCATTGGGCACTTTAGG - Intronic
1169871706 20:10254818-10254840 TTTAATGCACTGGGCAGTCTCGG + Intronic
1173034167 20:39392800-39392822 TATTATTCACAAGTCAGTCTAGG - Intergenic
1173190770 20:40874082-40874104 CATTAAGCACAGGGAACTGTAGG + Intergenic
1173427767 20:42957875-42957897 CATTCTGCACAGGGCACTCCTGG - Intronic
1177760155 21:25394124-25394146 GATTATGCAGAAGCCACTCTGGG + Intergenic
1180015319 21:45078553-45078575 TCTCAGGCACAGGGAACTCTCGG + Intronic
951037451 3:17949671-17949693 TATTATGATGAGGGCTCTCTAGG + Intronic
958461395 3:94401582-94401604 TACTGTGCATAGGCCACTCTGGG + Intergenic
964842271 3:161007271-161007293 TATTGTGCACAGTGCAATCAAGG + Intronic
965452581 3:168857131-168857153 TTTTATGCCCAGGGGACCCTTGG + Intergenic
975835345 4:78417251-78417273 TATTGTGGACATGGCACTGTGGG - Intronic
975935567 4:79575522-79575544 TATTAAGCAGAGGGCCTTCTGGG + Intergenic
977100128 4:92800770-92800792 CATTATGCCTAGGCCACTCTTGG + Intronic
978487533 4:109272616-109272638 TACTATGGACAAGGCACTGTGGG + Intronic
983469860 4:168142841-168142863 CATTATGCACAAGGATCTCTTGG - Intronic
993071724 5:83173136-83173158 GAGTATGCCCAGGGCACTGTAGG + Intronic
993135325 5:83953858-83953880 TAATATGAATAGAGCACTCTTGG - Intronic
996671301 5:126121033-126121055 TACTATGCACTAGGCACTCACGG + Intergenic
1000778699 5:165452333-165452355 AATTATGTACAGGAAACTCTTGG - Intergenic
1001510790 5:172320279-172320301 TAATAGCCACAGGGGACTCTGGG - Intergenic
1003600294 6:7510657-7510679 TAGTATACAAAGGGCATTCTTGG - Intergenic
1006688175 6:35855490-35855512 TAATATTCACAGGCAACTCTGGG - Intronic
1008422353 6:51316512-51316534 TATGATGCACTTGGCACTATGGG + Intergenic
1014920330 6:127207139-127207161 TATTATTGACCGTGCACTCTTGG + Intergenic
1016827136 6:148398937-148398959 TTTTTTGCACATGGCACTATGGG + Intronic
1018425962 6:163680808-163680830 TATTATGGACATGGCTCTCGTGG + Intergenic
1020479204 7:8637010-8637032 TACCATGCACAGGGCTCTCAAGG - Intronic
1022360038 7:29649000-29649022 TATTAACCACAGTGCTCTCTTGG - Intergenic
1022609627 7:31856548-31856570 TATTGTGCAGAGTGTACTCTGGG - Intronic
1022970666 7:35513955-35513977 TCTTAGACACAAGGCACTCTTGG - Intergenic
1029684031 7:102133176-102133198 CATGATGCACAAGGCACTTTGGG + Intronic
1031568516 7:123329579-123329601 AAATATGTACAGGACACTCTCGG - Intergenic
1034002717 7:147433454-147433476 TGTTATCTGCAGGGCACTCTGGG + Intronic
1035873526 8:3161883-3161905 AACTATGCACAGAGCATTCTAGG - Intronic
1037279181 8:17217051-17217073 TATTATGTACAAGGCACCTTTGG + Intronic
1038238763 8:25788180-25788202 TAAGATGCACAGGGTACTATGGG - Intergenic
1039365394 8:36923227-36923249 TACTCTGCACAGGGCACTGTTGG + Intronic
1041299506 8:56396195-56396217 TATTATGGAGAAGGCATTCTGGG + Intergenic
1046523635 8:115357145-115357167 TATTATGTACTGGGCACTATAGG - Intergenic
1046575831 8:116027640-116027662 TTTTATGCAAAGGCCACTGTGGG - Intergenic
1047650466 8:126914672-126914694 TAAGAAGCACAGGCCACTCTTGG - Intergenic
1049725649 8:144144504-144144526 TAGTGCCCACAGGGCACTCTGGG - Intergenic
1050685436 9:8163608-8163630 TTTTCTGCACAGGCCACACTGGG + Intergenic
1058150134 9:101454535-101454557 ACTTATGCACAGGGCACTCCTGG - Intergenic
1059513830 9:114874851-114874873 TAATGTGCATAGGGCACTCTGGG + Intergenic
1062474659 9:136721052-136721074 CATTCTGCACTGGGCACTCATGG - Intronic
1194231447 X:91330075-91330097 AAATATGCACAGGGCATTATGGG + Intergenic
1194718741 X:97316192-97316214 TATTATTTACATGGCACACTAGG - Intronic
1198187161 X:134264662-134264684 TATTCTGAACAAGGCACTATTGG + Intergenic
1199498059 X:148476049-148476071 GAATATGCAGAGGGCACTGTGGG + Intergenic