ID: 924272033

View in Genome Browser
Species Human (GRCh38)
Location 1:242343919-242343941
Sequence CTGAATAAACAAATGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 910
Summary {0: 2, 1: 16, 2: 57, 3: 145, 4: 690}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924272033 Original CRISPR CTGAATAAACAAATGGACAA TGG Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900492433 1:2958940-2958962 CAGGATAGACACATGGACAAAGG + Intergenic
900857004 1:5194324-5194346 ATGAACAAACAAATAGATAAAGG + Intergenic
901266834 1:7917337-7917359 CAGGATAGACAAATTGACAATGG + Exonic
902129823 1:14250141-14250163 CTGAATAAACATGTGTATAAAGG - Intergenic
902660688 1:17900653-17900675 CTCAATTAAAAAATGGGCAAAGG + Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903234459 1:21940659-21940681 ATGAATGAATGAATGGACAAAGG - Intergenic
903748761 1:25605521-25605543 CTCAATTAAAAAATGGGCAAAGG + Intergenic
904050864 1:27637447-27637469 GTGAATCAACCAAAGGACAAAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905510064 1:38512144-38512166 GTAAACAAACAAATGGATAACGG + Intergenic
905593162 1:39182522-39182544 CCCAATAAAAAAATGGGCAAAGG + Intronic
905807350 1:40886488-40886510 CTGAATAAACAAGTGAACACTGG + Intergenic
906172000 1:43734133-43734155 CTGAGTAAATAAAGAGACAAAGG - Intronic
906338535 1:44956747-44956769 CTGAATAAGCATTTGGAAAAAGG + Intronic
906549176 1:46647953-46647975 GAGGATAGACAAATGGACAAAGG - Intronic
907114002 1:51952669-51952691 ATGAATAAAGGAATGAACAAAGG + Intronic
907589719 1:55654658-55654680 ATAAATAAATAAATGGAAAAGGG + Intergenic
907701593 1:56793446-56793468 CTCCATTAAAAAATGGACAAAGG + Intronic
907833056 1:58083467-58083489 CTGAATAATGGAATGGACAAAGG + Intronic
908223049 1:62027806-62027828 CTCATTAAAAAAATGGGCAAGGG - Intronic
908342047 1:63191635-63191657 CTGTCCAAACAGATGGACAAGGG - Intergenic
908679766 1:66647751-66647773 CTGCATAAACAGAGGGACACTGG - Intronic
908694381 1:66821673-66821695 TTAAATAAAAAAATGGGCAATGG - Intronic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909491249 1:76229054-76229076 CTGATTATATGAATGGACAATGG + Intronic
909506706 1:76399379-76399401 CTGAATAACCTCATGGAAAAAGG - Intronic
909584971 1:77279927-77279949 CCAAATAAACAAAGGGCCAAGGG + Intergenic
910010369 1:82453702-82453724 CTGAATCAACAAGTGAAGAAAGG + Intergenic
910159909 1:84261546-84261568 CTGATTTAAAAAATGGGCAAAGG + Intergenic
910372861 1:86536664-86536686 ATTAATATACTAATGGACAAAGG - Intergenic
910419474 1:87042145-87042167 CTCAATTAAAAAATGGGCAAAGG - Intronic
911724651 1:101230293-101230315 GTGAATAAAAAAATGGAAAGTGG + Intergenic
911961859 1:104314679-104314701 CTGAATAATCATATTGTCAATGG - Intergenic
912228489 1:107763886-107763908 CTGAACAAAGAAAAGGAAAAGGG + Intronic
912591599 1:110826297-110826319 CTCAATTTACAAATGGGCAAGGG + Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
914399462 1:147304182-147304204 AAGAATAAAAAAGTGGACAAAGG + Intergenic
914425146 1:147569135-147569157 ATGGGTGAACAAATGGACAAAGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
915153166 1:153851601-153851623 ATTAAAAAAAAAATGGACAAAGG - Intronic
915184177 1:154090508-154090530 CTGATTCAAAAAATGGGCAAAGG + Intronic
916294994 1:163208616-163208638 AAAAATAAAGAAATGGACAAGGG + Intronic
916522320 1:165575282-165575304 CTCAATGGACAAATGGACACTGG - Intergenic
917078768 1:171235311-171235333 CTGAATATACAAAGGGCCACAGG - Intergenic
917120621 1:171641857-171641879 CTGAGCAAACAAATGATCAAAGG - Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
917783281 1:178423810-178423832 CTCAATAGAAAAATGGGCAAAGG - Intronic
917984268 1:180298863-180298885 CTGAATAACTTAAAGGACAAGGG + Intronic
918201446 1:182271023-182271045 CTGAATAAATAAATAAATAAGGG + Intergenic
918462236 1:184788708-184788730 CCGAAAAAACACATGGACACAGG - Intergenic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919315992 1:195970846-195970868 CTGAATAAGAAAATGAAGAAAGG + Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920612173 1:207452397-207452419 ATGAATAAATAAATAGAGAAGGG + Intergenic
921012577 1:211157458-211157480 CTGAAAAAACAAAAGAACTAGGG + Intergenic
921057898 1:211558017-211558039 CTCAATTAAAAAATGGGCAAAGG + Intergenic
921427142 1:215016915-215016937 CCCAATTAACAAATGGGCAAAGG + Intronic
921469010 1:215526214-215526236 ATGAATAAACTATTGGACAATGG + Intergenic
921594061 1:217035979-217036001 CTAATTTAAAAAATGGACAAAGG + Intronic
922369371 1:224893858-224893880 CTGAATAGGAAAATAGACAATGG - Intergenic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922631508 1:227118220-227118242 CTCAATCAAAAAATGGGCAAAGG + Intronic
922742279 1:228020705-228020727 ATGAATAAAGAAGTGAACAAGGG + Intronic
923236966 1:232043365-232043387 GTGAATAAATAAATAAACAATGG - Intergenic
923415433 1:233753372-233753394 CTAAAAAAATAAATGGACACAGG + Intergenic
923428857 1:233900518-233900540 CCCAATTAAAAAATGGACAAAGG + Intergenic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
923474161 1:234317202-234317224 CTAAATAAATAAAAGTACAACGG + Intronic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062780043 10:194726-194748 CTCCATAAAAAAATGGGCAAAGG - Intronic
1063247880 10:4242081-4242103 ATAAATAAATAAATGCACAAAGG - Intergenic
1063398865 10:5721606-5721628 GTGAATAAGCAAATAGAGAAGGG + Intronic
1063438323 10:6052464-6052486 CTGAATGAATGAATGAACAAAGG + Intronic
1063597258 10:7447194-7447216 AATAAAAAACAAATGGACAAAGG - Intergenic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1064157157 10:12912443-12912465 CTGATTTAAAAAATGGGCAAAGG - Intronic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1064772357 10:18736482-18736504 CCCATTAAAAAAATGGACAAAGG + Intergenic
1065439228 10:25732650-25732672 CCCAATTAAAAAATGGACAAAGG - Intergenic
1066230820 10:33431270-33431292 ATGAATAAAAGAATGTACAAGGG + Intergenic
1066261134 10:33730676-33730698 CGGATCAAACAAATGCACAAAGG + Intergenic
1066466535 10:35655440-35655462 GAGAAAAAAAAAATGGACAAAGG - Intergenic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1066678331 10:37912165-37912187 CTGGTTAAAAAACTGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1066752683 10:38674897-38674919 CTCAACAAAAAAATGGACAAAGG + Intergenic
1066964350 10:42248129-42248151 CTCAACAAAAAAATGGACAAAGG - Intergenic
1067457293 10:46428059-46428081 CTGAAAAAGAAAATGGCCAATGG + Intergenic
1067629909 10:47956579-47956601 CTGAAAAAGAAAATGGCCAATGG - Intergenic
1067709803 10:48638775-48638797 CTTAATGAACAAAGGGATAATGG + Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069647773 10:70016737-70016759 CCCAATTCACAAATGGACAAAGG + Intergenic
1069764396 10:70842875-70842897 CTGAATACAAACATGGACAGGGG - Intronic
1070448466 10:76532394-76532416 ATGAATAAATAAATGTATAAAGG - Intronic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1071352077 10:84756690-84756712 TTGAATATATAAATAGACAAGGG + Intergenic
1071354444 10:84779370-84779392 CAGAATAAACAAATGACCTACGG - Intergenic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1071547612 10:86540249-86540271 CTGATGAAACAAGTGCACAAAGG - Intergenic
1072177719 10:92945194-92945216 CTGAATTAAAAAGTGGGCAAAGG - Intronic
1072370292 10:94759268-94759290 TTGATTAAAAAAATGGGCAACGG + Intronic
1072910778 10:99498945-99498967 CTAAATAAAAACATTGACAAAGG - Intergenic
1073648059 10:105327331-105327353 GTGAATTAACAAATGCAAAAAGG - Intergenic
1074053241 10:109899017-109899039 CTGAATGAATAAATGGCCATCGG + Intronic
1074363434 10:112840018-112840040 CTGGATACACAAATGGAGGAGGG + Intergenic
1074553241 10:114464501-114464523 CTTATTACCCAAATGGACAAAGG + Intronic
1074608187 10:114995017-114995039 ATAAATAAATAAATGTACAAAGG - Intergenic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1075535825 10:123271346-123271368 CTGAATAAACAAAAGGTGAAGGG + Intergenic
1075538503 10:123292654-123292676 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1075538568 10:123293229-123293251 CTGATTAAAAAAATGGGCAAAGG + Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076766393 10:132636643-132636665 ATAAATAACCAAATGGACATGGG - Intronic
1077479903 11:2808874-2808896 ATGGATGAACACATGGACAATGG + Intronic
1077481951 11:2819094-2819116 ATGAATGAACCAATGAACAAAGG - Intronic
1077958104 11:7043161-7043183 CTGAAGCAGCAAATGGAGAAGGG + Exonic
1078340156 11:10492890-10492912 CTGAAGAAACACGTGGGCAAAGG + Intronic
1078548661 11:12264801-12264823 CTGAATAAATGAATGCATAAAGG - Intergenic
1078589802 11:12630394-12630416 CTTAATAGAAAAATGGACAAAGG - Intergenic
1078612075 11:12829609-12829631 CTCAATAAATACATGGATAAAGG - Intronic
1078635896 11:13049794-13049816 ATGAATAAATAAGTGGAGAAGGG - Intergenic
1080117295 11:28635254-28635276 CTGAATGAATAAATGAATAAAGG - Intergenic
1080308428 11:30862077-30862099 TGGAATAAACAAATGGGCCATGG + Intronic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081170531 11:39864565-39864587 CTAAATAACCAAAGGGTCAAAGG - Intergenic
1081290230 11:41315862-41315884 CTCAATAAATAGATGTACAAAGG + Intronic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082565344 11:54670895-54670917 CTCAATCAAAAAGTGGACAAAGG + Intergenic
1082749871 11:57004104-57004126 TGGAAGAAATAAATGGACAAAGG + Intergenic
1082881594 11:58043387-58043409 ATGAATAGACAAATAGACAAAGG - Intronic
1082916318 11:58441946-58441968 CTGATTAAACCAAAGGAGAAAGG + Intergenic
1084195399 11:67521689-67521711 CTGAATGAACAAATATAAAAGGG + Intronic
1084467936 11:69337820-69337842 CTCAGTAAATATATGGACAATGG - Intronic
1084908164 11:72364907-72364929 CTAATTTAAAAAATGGACAAAGG + Intronic
1085343208 11:75747332-75747354 CCTAATTAAAAAATGGACAAAGG + Intergenic
1085370218 11:75996358-75996380 ATGAATAAATGAATTGACAAAGG - Intronic
1085560825 11:77472173-77472195 CTGAATAAGCAAATTTACCAAGG + Intronic
1085842827 11:80032598-80032620 CTCAATTAAAAAATGGACTAGGG + Intergenic
1085912331 11:80842445-80842467 CTCAATAAACAAATGTTGAATGG + Intergenic
1086056938 11:82658052-82658074 CTCTATAAAAAAATGGGCAAAGG + Intergenic
1086224989 11:84497074-84497096 CTAATTAAACAAATAGATAATGG + Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1086538120 11:87874403-87874425 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087608182 11:100402945-100402967 TTGAATATACAAATAGGCAATGG + Intergenic
1087879305 11:103396098-103396120 AGTAATCAACAAATGGACAAAGG - Intronic
1087882903 11:103439780-103439802 CTGAATGAATGAATGAACAAAGG + Intronic
1087934656 11:104018451-104018473 CTCAGTTAACGAATGGACAATGG - Intronic
1088333713 11:108679838-108679860 CTTAATAAACGAAGGGAGAAGGG + Intronic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1090254159 11:125271520-125271542 CTGAATGAACAAATGAAAACAGG - Intronic
1090883345 11:130854029-130854051 ATGAATAAACAAAGGAGCAAAGG - Intergenic
1091086059 11:132723106-132723128 CTGAAGAAACAAGAGAACAAAGG + Intronic
1091318013 11:134629315-134629337 CTGGATTAAAAAATGGACAAAGG + Intergenic
1091356187 11:134939645-134939667 CTGCCAAAACAAATGGTCAAAGG + Intergenic
1091541068 12:1463129-1463151 CCGAGAAAACAAATGGAGAAAGG - Intronic
1091695724 12:2626907-2626929 ATGAGTAAATAAATGGACGAAGG + Intronic
1093328671 12:17809811-17809833 CTGAATAAACTAATAAAGAAGGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094425908 12:30316863-30316885 CTGAACAGACAAGAGGACAAAGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095535273 12:43238557-43238579 CTGAATACACAAACAGATAATGG - Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1095857180 12:46873184-46873206 CTGAATAAACAAATAGATGAAGG + Intergenic
1096036903 12:48480282-48480304 CTCAATTAAAAATTGGACAAAGG - Intergenic
1096908147 12:54955302-54955324 CCAATTAAAAAAATGGACAAAGG + Intronic
1097124076 12:56759472-56759494 CATAATAAACAAAAGGAGAATGG + Intronic
1097594008 12:61605166-61605188 CTATTTAAAGAAATGGACAAAGG - Intergenic
1097873430 12:64621319-64621341 CCTAATAGACAAATGGGCAAAGG - Intronic
1098024952 12:66191474-66191496 ATGAATACACAAAGGGACAATGG - Intronic
1098079306 12:66766918-66766940 GAGAATGAACAAATGGATAAGGG + Intronic
1098280125 12:68854278-68854300 CTGAATGAATGAATGAACAAGGG - Exonic
1098424271 12:70341512-70341534 CAGAATAAATAAATAAACAATGG - Intronic
1098600021 12:72319736-72319758 ATGAATAAAAAAATAAACAATGG - Intronic
1098944715 12:76576741-76576763 CTGAATAACCACTTGGTCAAAGG + Intergenic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1100342700 12:93695906-93695928 ATAAATAAATAAATGGGCAAAGG + Intronic
1100359709 12:93864985-93865007 ATGAATAAACAAATGAATGAGGG + Intronic
1100925563 12:99543794-99543816 CAGAATAGACAAATTGATAAAGG + Intronic
1101201302 12:102439193-102439215 ATGAATAAATGAATGGAGAAGGG + Intronic
1101475411 12:105042129-105042151 CTAAATAAAGAAATGGATATAGG - Intronic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1101887204 12:108675746-108675768 CAGAATACACAAATGGAAAAAGG + Intronic
1102738432 12:115184063-115184085 ATCAATGAACAAATGGATAAAGG + Intergenic
1102999192 12:117372299-117372321 ATAAATAAAGAAATGGACATTGG - Intronic
1103130477 12:118464126-118464148 CTGAATAAATATTTGCACAATGG + Intergenic
1103430484 12:120880881-120880903 CCAAAAAAAAAAATGGACAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104167527 12:126248397-126248419 CTGAAAAAGCAAAAGAACAATGG + Intergenic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104754208 12:131258703-131258725 ATGAATAAGTAAATGGAGAAGGG - Intergenic
1105282194 13:18972668-18972690 CTGAATGAAAAAATGGGCAAAGG + Intergenic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106071412 13:26415572-26415594 GTGAATAAACAAATGCAGCAAGG + Intergenic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106359943 13:29021800-29021822 TTGAATAAACAAAGACACAAGGG + Intronic
1106807922 13:33330416-33330438 CTGGATTAAAAAATGGGCAAGGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107404837 13:40102753-40102775 GTGAATAAACAAATTCACTAAGG - Intergenic
1107541951 13:41397016-41397038 CTCAATTAACAAATGGGCAAAGG + Intergenic
1107542006 13:41397362-41397384 CAAAAAAACCAAATGGACAAAGG + Intergenic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108161281 13:47642482-47642504 CTGAACCAACTAATTGACAATGG - Intergenic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108971852 13:56386350-56386372 CTGGATAAAAAAATGGGCAAAGG + Intergenic
1109438036 13:62332174-62332196 CTGGATACACAAAGGGACAGTGG - Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109747840 13:66649258-66649280 CTTAATAATCAAATTGTCAAAGG + Intronic
1109825165 13:67709646-67709668 CTGAATATGAAAATGGACAGTGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110747950 13:79078702-79078724 CTCAATTAAAAAATAGACAAAGG + Intergenic
1111325207 13:86685299-86685321 TTGAATAAACAAATAAATAAAGG + Intergenic
1111534701 13:89587778-89587800 CAAAATAAACTAAAGGACAAAGG - Intergenic
1111565585 13:90010624-90010646 TTGAATAAACAAACGGAATAGGG + Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1111899588 13:94184458-94184480 CCCATTAAAAAAATGGACAAAGG + Intronic
1112188791 13:97154772-97154794 CTGAATAAATAAATGGTATAAGG + Intergenic
1112273400 13:97992558-97992580 CTGAAAAAATAAAAGGACAAAGG + Intronic
1112332654 13:98488502-98488524 CCCAATAGAAAAATGGACAAAGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1112944351 13:104908514-104908536 CTGAATAACCAATGGGTCAATGG - Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114169308 14:20255807-20255829 CTGAATAAATAAACAGAAAAGGG + Intergenic
1114305734 14:21421080-21421102 CTGAAAAATCAAATGGCAAATGG + Intronic
1114368478 14:22057252-22057274 CTGCATTAAAATATGGACAAAGG + Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1115752669 14:36506989-36507011 TGGAATAAAGAAATGGAAAATGG + Intronic
1115794672 14:36921303-36921325 CTGTATGAACAAATGAACTATGG - Intronic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116360230 14:43985225-43985247 CTTAACAAACAAAAGGAGAAAGG - Intergenic
1116477224 14:45354535-45354557 TTGTATAAATGAATGGACAAAGG + Intergenic
1116516170 14:45808889-45808911 CTGAATTAATTAATGGACAGTGG + Intergenic
1116625610 14:47259084-47259106 CTAAACAAACAAATGGAAATTGG - Intronic
1116880964 14:50168551-50168573 CTGACTAAAAAAATGAGCAAAGG - Intronic
1117925303 14:60772846-60772868 CTGAATAAGCAAATGAAGTAAGG + Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1118897897 14:69962075-69962097 CTGAATTAAGAAATGGGAAAAGG - Intronic
1119105696 14:71921486-71921508 ATGAATAAAGAAATATACAATGG + Intergenic
1120073503 14:80129738-80129760 CTGATTAAAAAAATGGAAAAGGG + Intergenic
1120301846 14:82717470-82717492 GTGAATAAACAAATCTTCAAAGG - Intergenic
1120489577 14:85160299-85160321 ATGAATTAACAAATGGAAGAAGG - Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1121577418 14:94999501-94999523 CTGAATAGAAAATTGAACAAAGG + Intergenic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122364193 14:101184538-101184560 CTCAATAGGAAAATGGACAAAGG - Intergenic
1123166917 14:106334475-106334497 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123169532 14:106359186-106359208 CAGGAAAAACAAATGGAAAAAGG + Intergenic
1123455704 15:20422408-20422430 CTCCATTAAAAAATGGACAAAGG - Intergenic
1124157857 15:27243698-27243720 ATGAATATGCAAATAGACAATGG - Intronic
1124716120 15:32063892-32063914 CTGGATCCACAAATGGAGAATGG - Intronic
1124805497 15:32877855-32877877 ATGAATGAGCAAATGAACAATGG - Intronic
1125174054 15:36799629-36799651 TTGAATAAACAAAATGCCAAAGG - Intronic
1125392718 15:39212422-39212444 CTGAATAAACTTATAGACATAGG - Intergenic
1127751898 15:62054049-62054071 TTGAAAAATCAAATTGACAAAGG + Intronic
1127898900 15:63326715-63326737 CACAATAAAAACATGGACAAAGG + Intronic
1128238560 15:66084274-66084296 CTGATTAAAAAAATGGGCAAAGG + Intronic
1128436633 15:67657205-67657227 CTAATTAACTAAATGGACAATGG - Intronic
1129127703 15:73458700-73458722 GGGGATAAAGAAATGGACAAAGG + Intronic
1129359413 15:75015242-75015264 CTGAATAAACAAAGGAAGGAGGG - Intronic
1129554397 15:76490472-76490494 CTTAATTAAAAAATGGACAAAGG - Intronic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130810839 15:87377052-87377074 TTCAATATAAAAATGGACAAAGG + Intergenic
1131105566 15:89731759-89731781 CTCAATAAACACATGGGCAGTGG - Intronic
1131792357 15:95978969-95978991 ATGAATAAAGAAATGAATAAAGG - Intergenic
1131912284 15:97221090-97221112 GTGAATGAAGAAATGAACAATGG - Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1131971835 15:97901300-97901322 CTGCATAAAGAAATGGAAATGGG - Intergenic
1132130283 15:99271088-99271110 CTCAATTAAAAAATGGGCAAAGG - Intronic
1133016781 16:2946651-2946673 CCCAATTAACAAATGGCCAAAGG + Intronic
1133512586 16:6474106-6474128 CTGCATACACAAATGGACACTGG - Intronic
1133563022 16:6967216-6967238 ATGTATAAACAAATGGATGATGG - Intronic
1133598541 16:7316834-7316856 CTGGAAAAACAAAGGGACCAGGG + Intronic
1134315366 16:13113926-13113948 ATGAATGAACAAATGAATAATGG - Intronic
1134444159 16:14318204-14318226 CAGAATAAACAAATCCACAGGGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1136607465 16:31346087-31346109 CTGAATATACAAAGGGATAGTGG + Intergenic
1137354351 16:47745321-47745343 TTGAATAAACTAATGGCCATAGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1138326495 16:56175676-56175698 CTCAATTTAAAAATGGACAAAGG - Intergenic
1139019393 16:62728630-62728652 CTAAAATAAGAAATGGACAAGGG - Intergenic
1140250956 16:73293891-73293913 CGGATGAAACAAATGTACAATGG - Intergenic
1140587491 16:76310129-76310151 CTGAATACACAAATGGCAAATGG - Intronic
1140637934 16:76938596-76938618 AGGAACACACAAATGGACAATGG + Intergenic
1141260534 16:82449520-82449542 TTGAATAAACAAATGAATGAAGG + Intergenic
1142656444 17:1397732-1397754 CTCAATAAAGGAATGGACACAGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144067330 17:11636360-11636382 CTGGATAAACCAATAAACAAAGG - Intronic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1146147318 17:30431288-30431310 CTCAATTAAAAATTGGACAAAGG - Intronic
1146246623 17:31290046-31290068 CTCAATGAATAAATGGGCAAAGG - Intronic
1146402610 17:32511830-32511852 CTGAATAAGCAAATATATAATGG - Intronic
1146670430 17:34733738-34733760 TTGAAAGAACAAATGAACAAAGG - Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1150198476 17:63327044-63327066 CTGATTAAAAAAATGGGCAAAGG + Intronic
1150214284 17:63457986-63458008 TAGAATAAATAAATGGACTAGGG + Intergenic
1151045124 17:70910909-70910931 CTGAATTAATAAACGGACAAAGG + Intergenic
1151060136 17:71082127-71082149 CTGAATAAATAACATGACAAAGG + Intergenic
1151174552 17:72276395-72276417 CTGACTAAAGCAATCGACAAAGG - Intergenic
1151252900 17:72851271-72851293 ATGAATAAACAAATAGCCCAGGG - Intronic
1152986233 18:323950-323972 CTGGAAAAACAAATGGAGAAAGG - Intronic
1153654824 18:7273236-7273258 CTAAAAAAACAAAAGGATAATGG + Intergenic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1153783988 18:8517962-8517984 CAGAACAAAAAAATGGACAAAGG + Intergenic
1153915155 18:9738446-9738468 CTGATTAAACCAATGGCCACTGG - Intronic
1154397925 18:14008943-14008965 ATGAATAAATAAGTGGGCAAAGG - Intergenic
1155582119 18:27321230-27321252 ATGAATACAGTAATGGACAATGG - Intergenic
1155582123 18:27321279-27321301 TTAAATACAGAAATGGACAATGG - Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1155859418 18:30878183-30878205 CTGAATTAAGATAAGGACAAAGG + Intergenic
1156068006 18:33168520-33168542 TTGTATAAACAAATTAACAAAGG - Intronic
1156488789 18:37484374-37484396 CTGAAAAAACAACTGGGGAATGG + Intronic
1156879332 18:42057954-42057976 CTGAATAAAGAAATGGTAGAAGG + Exonic
1157001936 18:43537194-43537216 ATGTACAAACAAATTGACAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157350397 18:46879224-46879246 CTCAATTCAAAAATGGACAAAGG + Intronic
1158156014 18:54426249-54426271 CTAGATAAACAAATAGTCAAGGG - Intergenic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158163395 18:54511513-54511535 CTGACTAAAAAAATGGGCAAAGG + Intergenic
1158512468 18:58103120-58103142 CTACATAGACAAATAGACAAAGG - Intronic
1158618947 18:59013556-59013578 TTGAATAAACATATGTACTATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159528543 18:69626400-69626422 ATGAATAAAGAAATGAAGAAAGG - Intronic
1159637737 18:70825914-70825936 CTGAATACGCAAATGGATAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161790649 19:6357922-6357944 CTGATTAAACAAAGGGAGACAGG + Intergenic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1162362779 19:10229991-10230013 ATGAATGAACCAATGAACAAAGG + Intronic
1162609774 19:11739884-11739906 CTTCATAAACATATGGAGAAAGG - Intergenic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165967153 19:39592119-39592141 CTGCATAAAAAAGTGGGCAAAGG + Intergenic
1166272459 19:41723485-41723507 CCCAATTAATAAATGGACAAAGG - Intronic
1166456699 19:42947534-42947556 CCCAATTAAAAAATGGACAAAGG + Intronic
1166466656 19:43038400-43038422 CCCAATTAAAAAATGGACAAAGG + Intronic
1166493563 19:43281457-43281479 CCCAATTAAAAAATGGACAAAGG + Intergenic
1166867436 19:45848534-45848556 GTGAATAAACGGATGGTCAATGG + Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
1167704764 19:51074689-51074711 CCCAATTAAAAAATGGACAAAGG + Intergenic
1168269946 19:55244364-55244386 CTGGAGAAACACATGGACATGGG + Intronic
1168443042 19:56388337-56388359 ATGAAGAAACAAATGGTGAAAGG + Intronic
1168479727 19:56709561-56709583 CCCAATGAAAAAATGGACAAAGG - Intergenic
924972147 2:138187-138209 CGAATTAAAAAAATGGACAAGGG - Intergenic
925363894 2:3297958-3297980 GTGAATGAGCAAATGAACAAAGG - Intronic
925451571 2:3973651-3973673 CTGGATATACAAAGAGACAATGG - Intergenic
926040370 2:9667880-9667902 CTGCAGGAACAAATGGACACAGG + Intergenic
926554994 2:14347148-14347170 ATGAGTAAACAAATGTAGAACGG + Intergenic
926719307 2:15947518-15947540 CAGAATAAACAGATGGAAATGGG + Intergenic
926804385 2:16692242-16692264 CTGAATAATAAAATGAAGAAAGG + Intergenic
927071978 2:19540220-19540242 TTGAATTAACAAATGTAAAATGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
927609899 2:24527989-24528011 CTCAATTAAAAAATGGGCAAAGG - Intronic
927723369 2:25402061-25402083 TTGAAGAGAAAAATGGACAAAGG - Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928145347 2:28769602-28769624 CTGCAGAAAGAAATGAACAATGG + Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929678634 2:43965685-43965707 TTCAATTAACAAATGGGCAAAGG + Intronic
930008684 2:46917445-46917467 TTGAATGAATAAATGAACAAAGG - Intronic
930589430 2:53309722-53309744 CCCAATTAAAAAATGGACAAAGG + Intergenic
930930437 2:56875336-56875358 CTAAATAAACACATGTACAGAGG + Intergenic
931095434 2:58934967-58934989 CTGAATAATCAAATGAATCAAGG + Intergenic
932642099 2:73459535-73459557 ATAAATAAATAAATGGAGAAGGG - Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933011817 2:77074754-77074776 CTAAATCAAGAAGTGGACAAAGG + Intronic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
933617237 2:84495163-84495185 CTCAATAAATAAATGGTCAAAGG - Intergenic
933995513 2:87665763-87665785 ATGAATAGACATATTGACAATGG - Intergenic
934186340 2:89680180-89680202 CTCAACAAAAAAATGGACAAAGG - Intergenic
934315673 2:91917050-91917072 CTCAACAAAAAAATGGACAAAGG + Intergenic
935151887 2:100444947-100444969 TTCAATAAACAAGTGGACACCGG - Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935392052 2:102563068-102563090 ATAAATAAACAAATAGACTAAGG - Intergenic
935677981 2:105612347-105612369 CCGAATAAACAAACCCACAAAGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936298342 2:111285152-111285174 ATGAATAGACATATTGACAATGG + Intergenic
936547876 2:113408083-113408105 ATGAATAAAAAAAAGGAAAAGGG - Intergenic
937139228 2:119584633-119584655 ATGAATAGAGAAATGGGCAAAGG + Intronic
937436709 2:121887430-121887452 CTGAATGAACAAATGAATGATGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938869356 2:135457746-135457768 CTCAATTAAAAAATGGGCAAAGG - Intronic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939133981 2:138272857-138272879 TTGTATAAACAAATGGAAAAAGG - Intergenic
939152393 2:138488334-138488356 CTGAATAAATAACTGGAGAATGG + Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939866361 2:147476973-147476995 CTGAACCAACAAATGTACCAAGG + Intergenic
939922202 2:148129781-148129803 CTGAATAAGTGAATAGACAAAGG + Intronic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
940194270 2:151076106-151076128 CTCAATTAAAAAATGGGCAAAGG + Intergenic
940981516 2:160008867-160008889 CCCAATTAAAAAATGGACAAAGG + Intronic
941111479 2:161422867-161422889 CTGAACAATCAAATGGACACAGG + Intronic
941178742 2:162233541-162233563 CTCCATTAAAAAATGGACAAAGG - Intronic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
941926655 2:170902329-170902351 CTGAATATGCAAATGGAATAAGG + Intergenic
941949813 2:171143111-171143133 ATGAATGCACGAATGGACAAAGG + Intronic
942440876 2:176035166-176035188 CTGGTGAAACAAATGGCCAATGG - Intergenic
942862624 2:180634736-180634758 GTCAATAGAAAAATGGACAAAGG + Intergenic
943006070 2:182389420-182389442 CCCAATTAAAAAATGGACAAAGG + Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
944208117 2:197178570-197178592 CCAAATAAAGAAATGGGCAAAGG + Intronic
944213777 2:197233477-197233499 CAAAATTAACAAAGGGACAAAGG + Intronic
944604335 2:201337342-201337364 CTGAATAACCATATGCAGAAGGG - Intronic
945274308 2:207972785-207972807 CTGCAGAAAAAAATGGACCATGG - Intronic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945384928 2:209186237-209186259 CTCAATAAAGAAATGGTCAAAGG + Intergenic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946042269 2:216792480-216792502 CTGAATGAATTAATAGACAAAGG + Intergenic
946268020 2:218565385-218565407 CCTATAAAACAAATGGACAAAGG + Intronic
947062638 2:226183559-226183581 CTGAATGAATAAATGAATAACGG + Intergenic
947066352 2:226230082-226230104 CTCAATAAAAAAATGGGCAAGGG + Intergenic
947911367 2:233803010-233803032 GCGCACAAACAAATGGACAAGGG - Intronic
947938816 2:234030745-234030767 ATGAATAAATAAATGCATAAAGG - Intergenic
948108685 2:235436341-235436363 ATGAACAAACAAATGGTCTAGGG + Intergenic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1168893590 20:1309255-1309277 CTGTCTGAACAAAAGGACAAAGG - Exonic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169553719 20:6727521-6727543 CTGAATTATAAAATGTACAATGG - Intergenic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171842425 20:30230829-30230851 CCCTATCAACAAATGGACAAAGG - Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1171983017 20:31640238-31640260 GTGAATAAAGAAACGAACAAAGG - Intronic
1172017332 20:31885470-31885492 CTGGATAAACATATGGAAAATGG + Intronic
1172490712 20:35335126-35335148 CATTATAAACAAATGAACAATGG + Intronic
1173171052 20:40724193-40724215 TTGAACAAACAGATGGACATGGG - Intergenic
1173650072 20:44657823-44657845 CTGAATAAGAAAGAGGACAAGGG + Intergenic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173898058 20:46565899-46565921 CTGAGTAAACAAATGGCCATAGG - Intronic
1173916679 20:46713285-46713307 CAGAAAAAACAAGTGGAGAAGGG + Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1175291789 20:57880894-57880916 ATGAATAAACAAATGGCCAGGGG - Intergenic
1175346538 20:58281789-58281811 CTGAATAACTAAATGATCAAAGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177593075 21:23198515-23198537 TTGAATAAATAAATGAACATTGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177781605 21:25628011-25628033 CTGAAGAAATAATTAGACAAGGG + Intergenic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179033763 21:37742383-37742405 TTGAATACAGAAATGGACAGTGG - Intronic
1179623705 21:42635164-42635186 GTGGATGAACAGATGGACAATGG - Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179717139 21:43294726-43294748 CCCAATAGAAAAATGGACAAAGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1181475907 22:23167635-23167657 CTGAATACTGAAATGGACAGAGG + Intergenic
1181729801 22:24836754-24836776 CTGAATTCAAAAATGGACAAAGG - Intronic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1182006938 22:26968730-26968752 CTGAAAAAACAACAGAACAACGG - Intergenic
1182017808 22:27055541-27055563 TTAAATAAACAAATGGATGAAGG - Intergenic
1182106684 22:27694821-27694843 CTGAATAAAGAGATGGAGACAGG + Intergenic
1182336887 22:29589626-29589648 CTCAAAAAAAAAATGAACAAAGG + Intergenic
1182643468 22:31788102-31788124 TTAAAAAAACAAATGGGCAAAGG + Intronic
1183064232 22:35352604-35352626 CTGAAAAAACAAGCGGACATGGG - Intergenic
1184144310 22:42599882-42599904 CTGGAGAAACAAAGGGACCAAGG + Intronic
949740439 3:7227209-7227231 ATGAAAACACAAATGGTCAATGG - Intronic
950470857 3:13185405-13185427 CAGAATAAACAAGTAGACAAAGG - Intergenic
950526920 3:13529589-13529611 TTGAATAAATAAATGGATAAAGG - Intergenic
950981925 3:17316127-17316149 CTGAACATGCAAATGGGCAATGG - Intronic
951069903 3:18315380-18315402 ATCAATCAAAAAATGGACAAAGG - Intronic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
952088729 3:29858193-29858215 ATGAATTAAAAAATGGAAAAAGG - Intronic
952705633 3:36374933-36374955 CTGAATAAAACAATGACCAATGG + Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
954288034 3:49632933-49632955 CTGAAAAACAAAATGGGCAAAGG + Intronic
955200284 3:56845821-56845843 ATGAATAAAGAAATGAATAAAGG + Intronic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956867611 3:73384931-73384953 CTGCATAAACACAAGAACAAAGG + Intronic
957129035 3:76199564-76199586 ATGAATGTACAAATGGATAATGG + Intronic
957791808 3:84951367-84951389 TTGGATAAAGAAATGGATAAAGG + Intergenic
957938425 3:86973728-86973750 CTAAATAGTCAAATGGAGAAAGG - Intronic
958001241 3:87751694-87751716 ATGGATAGAAAAATGGACAATGG + Intergenic
958512517 3:95066566-95066588 CTCAATTAAAAAATGGACAAAGG + Intergenic
958530104 3:95317567-95317589 CTGATTAAAAGAATGGGCAAAGG + Intergenic
958765147 3:98359100-98359122 CTGAATAATCAAATTCCCAAAGG - Intergenic
958900985 3:99886575-99886597 TAGAACAAACAAATGAACAAAGG + Intronic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
959629165 3:108489088-108489110 CTGGATTAAAAAATGGATAAAGG - Intronic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959826266 3:110800184-110800206 CCTGATTAACAAATGGACAAAGG - Intergenic
959957935 3:112260344-112260366 CTAAAGAAAAAAATGGACATAGG - Intronic
959971237 3:112412430-112412452 CTGTGTAAAAAAATGGGCAAAGG - Intergenic
960344342 3:116513958-116513980 CTGAAAAATCAAATGGCTAAAGG + Intronic
960404895 3:117247750-117247772 CTTAATAAACAAATAGATAATGG - Intergenic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
960482200 3:118205644-118205666 CTTAATGAATAAATGGGCAAAGG - Intergenic
960483449 3:118222093-118222115 CTCAATTAAAAAATGGACAAAGG + Intergenic
960597984 3:119424152-119424174 CTGAATTAAAAAATAGGCAAGGG - Intergenic
960622399 3:119649336-119649358 ATGAATAAACAAATGGAGAATGG - Intronic
960675465 3:120190328-120190350 CTGATTTAACAAAGGCACAAAGG + Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
961697007 3:128712381-128712403 CTGAATAAATAAATGAAAGATGG + Intergenic
961700012 3:128736318-128736340 CTGAATGATAAAATGTACAAAGG - Intronic
961858630 3:129896166-129896188 CCCAATAAACCAATGGGCAAAGG + Intergenic
962047884 3:131779998-131780020 CTGCATTAAAAAATGGGCAAAGG + Intronic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
963385631 3:144589332-144589354 ATGAAAAAAAAAATGGAAAAAGG - Intergenic
963396946 3:144747110-144747132 CTTATTGTACAAATGGACAATGG + Intergenic
963401036 3:144800056-144800078 CCCAATAAAAAAATGGCCAAAGG - Intergenic
963565753 3:146928206-146928228 CTGAATGAATAAATGAATAAAGG - Intergenic
963664233 3:148162059-148162081 CTGAATAGAAAAAAGGGCAAAGG + Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964706114 3:159620464-159620486 CTGGATAAAGAAATAGACAATGG + Intronic
965268579 3:166582526-166582548 CTCCATCAAAAAATGGACAAAGG - Intergenic
965624281 3:170671576-170671598 GTGAATAAATGAATGGACTAAGG + Intronic
965816985 3:172647033-172647055 CTGAATAAAAGAATAAACAACGG + Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
966516105 3:180822230-180822252 CCCATTAAAAAAATGGACAAAGG + Intronic
967065474 3:185911491-185911513 CTAAACAAACAATTGGAAAAGGG - Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968164587 3:196454334-196454356 CTGAAGGAAGAAATGGAGAACGG + Intergenic
968195687 3:196704269-196704291 CCCAATAAAAAAATGAACAAAGG + Intronic
969337371 4:6519561-6519583 CAGAATTATCAAATGGGCAAGGG - Intronic
969837104 4:9850884-9850906 ATGAATGCACAAATGGACACTGG + Intronic
969964674 4:10982062-10982084 TTGAATAAATAGATGAACAAAGG - Intergenic
970008710 4:11435254-11435276 CTGAGTCAACTAATTGACAAAGG + Intergenic
970420311 4:15899620-15899642 CTGAATTAAGAAGTGGACACTGG - Intergenic
970504373 4:16712224-16712246 CTCAATTTACAAATGGGCAAAGG + Intronic
970648754 4:18154482-18154504 CTCAATTAAGAAATGGGCAAAGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971539960 4:27803551-27803573 CTGAATAAACAAATAAATGATGG - Intergenic
972112570 4:35583324-35583346 CTGAAAAAACTGATGAACAAAGG - Intergenic
972332096 4:38073549-38073571 CTCAATTAAAAAATGGGCAAAGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974007944 4:56578201-56578223 ATGAATAAATAAAAGTACAAAGG + Intronic
974497835 4:62656273-62656295 TTGAATAAAGAAATTGGCAAAGG - Intergenic
974629869 4:64474033-64474055 CTAAATAAGCAAATGTACATTGG + Intergenic
975609202 4:76187351-76187373 CCAGATAAGCAAATGGACAAAGG + Intronic
976137662 4:81956455-81956477 CTGAATTAAAAAATGGGCCAAGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977113339 4:92988785-92988807 TGGAATAAACAAACTGACAAAGG + Intronic
977137125 4:93319359-93319381 CTAAATTAAGAAATTGACAAGGG - Intronic
977162036 4:93646857-93646879 CTGAACAAATAAATGGATGATGG + Intronic
977598185 4:98907053-98907075 CTGAATAAATACTTGGAGAATGG - Intronic
977947920 4:102935158-102935180 CTCAACAAAAAAATGGACAAAGG + Intronic
978030471 4:103936152-103936174 CTCACTAAAAAAATGGGCAAAGG + Intergenic
979072530 4:116226993-116227015 CTGAATATTCAAATAGCCAAAGG + Intergenic
979336936 4:119474203-119474225 CTGGTTACACAAATGGCCAAAGG - Intergenic
979427981 4:120591614-120591636 GTGAATGAACAAATGGATACAGG + Intergenic
979880807 4:125957177-125957199 CTGAATAAAAAAGAGGACCATGG - Intergenic
980684524 4:136209337-136209359 TTGAATAAACTAATGAATAATGG + Intergenic
980757546 4:137185465-137185487 CCGATGAAAAAAATGGACAAAGG - Intergenic
981104860 4:140868835-140868857 TTCAATAGAAAAATGGACAAAGG + Intronic
981248894 4:142574785-142574807 CTGTATAAACAAACAAACAAAGG - Intronic
981250162 4:142591468-142591490 TTGAATAAATAAATGGAGAAAGG + Intronic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
981751222 4:148094003-148094025 CTGAATAAAAAAATTGATAAAGG + Intronic
982001059 4:151021616-151021638 CTTAATAACCAAATAGAGAAGGG - Intergenic
982163505 4:152593467-152593489 ATGCATAAACAAATCGACATTGG + Intergenic
982173460 4:152683404-152683426 CTGGATGTACAAATGGACAGTGG - Intergenic
982289981 4:153770306-153770328 CTCAATTTAAAAATGGACAAAGG - Intergenic
983614514 4:169687013-169687035 CAGAATAATCATGTGGACAAAGG - Intronic
983630733 4:169846653-169846675 TTAAATAAACAAATGAACTAAGG - Intergenic
983758620 4:171375992-171376014 CTGATTAAGTAAATGGACACTGG + Intergenic
983766582 4:171491530-171491552 CTGAATATATAAATGGATGATGG + Intergenic
984949747 4:184998498-184998520 CTGAATTAGAAAATGGAAAAAGG - Intergenic
985002742 4:185502146-185502168 CTCAATAAACAATAGGATAAAGG + Exonic
985438156 4:189954043-189954065 CTCAATAGAAAAATGGACAAGGG + Intronic
986461354 5:7975691-7975713 TTGAATACACCAAGGGACAATGG + Intergenic
986587088 5:9329729-9329751 ATAAATAAATAAATGTACAAAGG - Intronic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
986863327 5:11953346-11953368 CTCCACATACAAATGGACAAAGG - Intergenic
987105911 5:14639090-14639112 TTGAAAAAAAAAATGGGCAAAGG - Intergenic
987654689 5:20791573-20791595 CTGAATAACCACGTGGAGAAGGG - Intergenic
987691667 5:21274847-21274869 CTGAATACACTAACAGACAATGG - Intergenic
987927170 5:24357106-24357128 CTCAATGAAAAAATTGACAAAGG - Intergenic
987943744 5:24576677-24576699 CTAAATAAATAAATGAACAGGGG + Intronic
987946884 5:24621290-24621312 ATGAATAAATAAATGGATATGGG - Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
987964477 5:24853948-24853970 TTGAATGGACAAATGGACCAGGG - Intergenic
988508827 5:31848372-31848394 CTGAATAATTAAATGTATAAAGG + Intronic
988684076 5:33511330-33511352 ATGAATACACAAATAGACAATGG + Intergenic
988740949 5:34070268-34070290 CTGAATAACCACGTGGAGAAGGG + Intronic
989064919 5:37450567-37450589 CTGAATAAGTAAATGGATAGTGG - Intronic
989132497 5:38121755-38121777 CCCAATTAAAAAATGGACAAAGG - Intergenic
989255359 5:39360615-39360637 CTCAATAGAACAATGGACAAAGG + Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
989714548 5:44446141-44446163 CTGAGAAATGAAATGGACAAAGG - Intergenic
990257202 5:53983005-53983027 CTGCATCAAAAACTGGACAAAGG - Intronic
990414623 5:55574422-55574444 CAAAATAAATAAATGCACAAAGG + Intergenic
990536293 5:56726359-56726381 TTGAGTAGACAAATGTACAATGG - Intergenic
990584262 5:57195142-57195164 CTCAATAGAAAAATGGGCAAAGG - Intronic
990627396 5:57630118-57630140 GAGAATATACAAATGGATAATGG + Intergenic
990756840 5:59081598-59081620 TTGTATAACCATATGGACAAAGG - Intronic
990841384 5:60083206-60083228 CTGAATAAATAAATGAACTCAGG + Intronic
991502460 5:67290419-67290441 CTGAATAGAGAAAGGGAAAAGGG + Intergenic
991628545 5:68630501-68630523 ATGAATAAACAAAGGAAAAATGG + Intergenic
991748710 5:69775290-69775312 CTGAATACACTAACAGACAATGG + Intergenic
991800288 5:70355102-70355124 CTGAATACACTAACAGACAATGG + Intergenic
991828312 5:70654939-70654961 CTGAATACACTAACAGACAATGG - Intergenic
991892646 5:71354542-71354564 CTGAATACACTAACAGACAATGG + Intergenic
991912465 5:71575258-71575280 CTGGAAAAACAAATAGAAAAGGG + Intergenic
992065825 5:73107092-73107114 CTGATTCAAAAAATGGGCAATGG - Intergenic
992106989 5:73457586-73457608 ATCAGTAAACAAATGGACAAAGG + Intergenic
992227717 5:74635207-74635229 CACAATCAACAAATGGACCATGG - Exonic
992301798 5:75389793-75389815 CTGAGCAACCAAATGCACAAAGG + Intronic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993105086 5:83591431-83591453 ATGAAAAAATAAATGAACAAAGG - Intergenic
993958553 5:94267636-94267658 CTGAATAAATAAATTCATAAAGG - Intronic
993959184 5:94275883-94275905 CTGATTAAACAAATTAACTATGG + Intronic
994059091 5:95454152-95454174 CTGATAAAAAAAATGGGCAAAGG + Intergenic
994748228 5:103705878-103705900 ATGATTAAAGAAATGGAGAAAGG + Intergenic
995146379 5:108791454-108791476 ACGAACAAAAAAATGGACAAAGG - Intronic
995802787 5:116017528-116017550 CACAATAAATAAAAGGACAAAGG - Intronic
995816203 5:116171146-116171168 CTGCATCAAAAAATGGGCAAAGG + Intronic
996117826 5:119637580-119637602 TTTAAAAAAAAAATGGACAAGGG - Intergenic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997959842 5:138311869-138311891 CTCAATTAAAAAATGGGCAAAGG + Intronic
998661604 5:144245082-144245104 ATAAATAAATAAATGTACAATGG - Intronic
998906023 5:146906298-146906320 ATAAATAAATAAATGGAAAATGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999264870 5:150260095-150260117 TTAAATAAACCAATGGACAGAGG - Intronic
999475973 5:151899371-151899393 CTGAATACACAATTTGAAAATGG - Intronic
999761519 5:154704809-154704831 CTCCATTAAAAAATGGACAAAGG + Intergenic
999791958 5:154948649-154948671 CTTAATAAACTAATGGATAAAGG - Intronic
999854450 5:155578973-155578995 ATGAATAAACAAATGGTGAATGG + Intergenic
999861283 5:155649353-155649375 GAGAATAAATAAATGAACAACGG + Intergenic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
999937220 5:156500703-156500725 CTGAATAAACATATGCACTCTGG + Intronic
1000526354 5:162363355-162363377 CTGAATTACCAAATGGAGACTGG - Intergenic
1002360887 5:178669907-178669929 CGGAATAGACTAAGGGACAAAGG + Intergenic
1002390034 5:178903479-178903501 CTCAATATAAAAATGGGCAAAGG - Intronic
1002819944 6:715599-715621 ATGCATAAACAGATGGAAAATGG + Intergenic
1003002146 6:2346305-2346327 CTGAATAGACCAGTGGACAATGG + Intergenic
1003010769 6:2425347-2425369 CTGATTTTAAAAATGGACAAAGG - Intergenic
1003673677 6:8182797-8182819 CTGAAAATACAAATAGACAGAGG - Intergenic
1003776731 6:9375198-9375220 CTGTATAAACACATGCACCATGG + Intergenic
1004039347 6:11960490-11960512 CTGACTATAGAAATGGGCAATGG + Intergenic
1004045526 6:12019241-12019263 CTGAGTAAGCAAAGGGACAGAGG + Intronic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005001171 6:21243483-21243505 ATGAATAAATAAATGAAAAATGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005795223 6:29353339-29353361 CTGAATAAATATATGAACATGGG - Intergenic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1007062513 6:38954811-38954833 CTGAATAAACCAATAATCAAGGG + Intronic
1008281110 6:49597349-49597371 GTGAATAAACAAAAAGAAAAAGG + Intergenic
1008419276 6:51278305-51278327 ATGAATAAACAAAAGCATAAAGG - Intergenic
1008483871 6:52014554-52014576 CTGGATAAACAGATGGATCATGG + Intronic
1008710694 6:54223048-54223070 CTCAATTAAAAAATGGGCAAGGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009038204 6:58143817-58143839 CTCAATTAAAAAATTGACAAGGG - Intergenic
1009236612 6:61132077-61132099 CTGCATCAACTAATGGGCAAAGG - Intergenic
1009522588 6:64702704-64702726 CTAAATAAACAAATGAGTAATGG - Intronic
1009961339 6:70525841-70525863 CTGAAAAAACAAATTGTAAAGGG - Exonic
1010380709 6:75221263-75221285 CTGAATAAAAAAATAGTCAGCGG - Intergenic
1010794374 6:80102514-80102536 CTATTTAAAGAAATGGACAAAGG - Intergenic
1011001889 6:82599488-82599510 TTGAATAAACATAAGCACAAAGG + Intergenic
1011104695 6:83766648-83766670 CTGACTAAAGAAATGGGGAAAGG + Intergenic
1011193627 6:84762208-84762230 CTAAATAAATACCTGGACAAGGG + Intronic
1011435530 6:87332769-87332791 CTGAAAAAGCAAATATACAAAGG - Intronic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011595807 6:89014720-89014742 CTCATTAAAAAAGTGGACAAAGG - Intergenic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012128424 6:95459332-95459354 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1012213554 6:96554887-96554909 CTGAATAAACAAAACGAAATTGG - Exonic
1012453479 6:99378905-99378927 ATGAATACATAAATGGACAGAGG + Intronic
1012875178 6:104717848-104717870 CTCGATAGGCAAATGGACAAAGG - Intergenic
1012954060 6:105549277-105549299 CTGAATAATGAAGTGGACAACGG - Intergenic
1012987478 6:105890251-105890273 CTTAAAAAACAAAAGGACAGGGG + Intergenic
1013047397 6:106500492-106500514 CTGATTTAAAAAATGGAAAAAGG - Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013470197 6:110457384-110457406 CTCAAAAAACAAAAGGATAAGGG + Intronic
1014034029 6:116744593-116744615 CCCAATTAAAAAATGGACAAAGG - Intergenic
1014073510 6:117210775-117210797 CTGAATAAACAAAGGAAGAGAGG - Intergenic
1014605495 6:123469010-123469032 CTGAAAGAACAAATTGACACAGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1015095536 6:129410504-129410526 CTAACTAAACAAATTGAGAAAGG - Intronic
1015225190 6:130849617-130849639 CTGAATAGGAAAATGGACAAAGG + Intronic
1015846655 6:137527093-137527115 CTCAATTCAAAAATGGACAAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1017292395 6:152754881-152754903 CTGAATAAAGACATTCACAATGG - Intronic
1017452563 6:154567336-154567358 CTGAATCAACAAACAAACAAGGG + Intergenic
1017801506 6:157900288-157900310 CTCAATTAAAAAATGGACAAAGG - Intronic
1017991481 6:159492988-159493010 ATGAATAAAGGAAAGGACAAGGG + Intergenic
1018017132 6:159722669-159722691 CTGAAAATACAAATGGTAAATGG + Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018909202 6:168092303-168092325 CTCATTAAACAAATGCACACTGG + Intergenic
1019180447 6:170184321-170184343 CTGGATAACCAAGTGGAAAATGG - Intergenic
1019873079 7:3784529-3784551 CTAATTAAAAAAATGGACAAGGG + Intronic
1019969708 7:4530530-4530552 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1020365839 7:7379665-7379687 ATGAATAAATGAATGGAGAAAGG + Intronic
1020830721 7:13091508-13091530 CTGAAGACACAAATAGACAATGG - Intergenic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1020978241 7:15034883-15034905 CACAATAAACAAATGAATAATGG + Intergenic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021463023 7:20910474-20910496 ATGAATAGAATAATGGACAAAGG + Intergenic
1021606841 7:22416650-22416672 CTCAATAAAAAAATGGGTAAAGG + Intergenic
1023502995 7:40870766-40870788 ATAAGTAAACAAATGGAGAACGG - Intergenic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024133490 7:46382336-46382358 CATAATAGACAAATAGACAATGG + Intergenic
1024874945 7:54010953-54010975 CTGGACAAAAAAATGGGCAATGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1025021093 7:55480782-55480804 TTGAACACACAAATGGACATAGG - Intronic
1026449485 7:70514946-70514968 CTCAATAAAAATATGGACAAAGG - Intronic
1026681305 7:72468881-72468903 CTGAATTTAAAAATGGGCAAAGG - Intergenic
1026788008 7:73313817-73313839 CTGGAGAAAGAAATGGACACTGG + Intronic
1026981267 7:74528128-74528150 GTGAATATACAAATGGCTAAAGG - Intronic
1027215631 7:76181720-76181742 ATGAATCAACAAATAGAAAAAGG + Intergenic
1027732379 7:81891124-81891146 CTGAATTAAAAAATGGGCAAAGG + Intergenic
1027812448 7:82921899-82921921 CTTATTAAAAAAATGGTCAAAGG + Intronic
1027843120 7:83339388-83339410 CTGAATAAATAAATGGCCAGAGG - Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028572091 7:92301512-92301534 CTCAATTAAAAAATGGGCAAAGG - Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1030319045 7:108145411-108145433 GTTAATAAAGAAATGGAGAAGGG + Intergenic
1030873834 7:114789278-114789300 TTGAATAGAAAAATGGGCAAAGG - Intergenic
1030928378 7:115487040-115487062 CTGAATAAACACATACACATAGG - Intergenic
1031053882 7:116972979-116973001 GTGAATAAACAAATGGGTGAGGG - Intronic
1031090015 7:117343095-117343117 ATCAATCAACAAATGGATAAAGG - Intergenic
1031164887 7:118216072-118216094 GTGAATGTACAAATAGACAATGG + Intronic
1031469489 7:122152102-122152124 TTAAAAAAAAAAATGGACAAAGG - Intergenic
1032395549 7:131586736-131586758 CTGAATGAATAAATGGTAAAAGG - Intergenic
1032607544 7:133372056-133372078 CTGAACTTAAAAATGGACAAAGG - Intronic
1033363455 7:140654143-140654165 CTGAATACGCAAAGGGACAATGG - Intronic
1034173818 7:149084626-149084648 CTGCATTAAAAAATGGGCAAAGG - Intronic
1034242195 7:149619117-149619139 ATGAATAAATAAATAGACACTGG + Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035114224 7:156509295-156509317 CTGACTGAATAAATGGACAGTGG - Intergenic
1035426775 7:158783449-158783471 CTAAATAAAAAACTGGAGAAAGG - Intronic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1037698984 8:21255215-21255237 CAGAATAAAGAAATAGAAAAAGG - Intergenic
1037700619 8:21270989-21271011 CAGAATAAACAAAGGGAGAGAGG + Intergenic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038829229 8:31038395-31038417 CTCAATTAAAAAATGGGCAAAGG - Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039209205 8:35192824-35192846 CTGATTGAAAAAATGGATAAAGG - Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040056344 8:43060920-43060942 TTTAATCAAAAAATGGACAAAGG + Intronic
1040777240 8:51060256-51060278 GTGGATAAACAAATGTACACAGG - Intergenic
1040958007 8:52999743-52999765 CTGACTATACAAATGGGAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1040994037 8:53383242-53383264 CTCAATCAAAAAATGGGCAAAGG + Intergenic
1041046335 8:53890409-53890431 ATGAATAAAAAAATGGATACAGG - Intronic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041480944 8:58318882-58318904 TTCAATAAATAAATGAACAAAGG + Intergenic
1041502131 8:58550700-58550722 ATGAAACAACAAATGCACAATGG - Intergenic
1041562114 8:59229982-59230004 ATGCATTAACAAATGGGCAAAGG + Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042074262 8:64972441-64972463 CCCAATGAAAAAATGGACAAAGG - Intergenic
1042727730 8:71895397-71895419 CCATTTAAACAAATGGACAATGG + Intronic
1042884271 8:73530735-73530757 CTGAAAAAACAAAAAGATAAAGG + Intronic
1043210270 8:77505233-77505255 GTGGATAAAGAAAGGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043784684 8:84383827-84383849 CTGGATAAATAAATGAGCAAAGG + Intronic
1043953917 8:86340175-86340197 CTCAGTAAGAAAATGGACAAAGG + Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044229937 8:89762217-89762239 ATGAATAAACAAATGAACCTGGG + Intronic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044678766 8:94755882-94755904 CTCAAAAAAAAAAAGGACAATGG + Intronic
1044850562 8:96423290-96423312 CTGGATATACGAATGGGCAAAGG - Intergenic
1044920050 8:97159981-97160003 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1045102443 8:98858942-98858964 GTGAATAAATAAAAGGACTAAGG + Intronic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045783366 8:105894579-105894601 TTGAATAAATAAATGTAGAAGGG + Intergenic
1046041974 8:108916658-108916680 GTGAATTAACAAATGGATGAAGG - Intergenic
1046493626 8:114985382-114985404 CTGCATAAACAAGTGGGCGAAGG - Intergenic
1046558777 8:115811896-115811918 CTGATTAAAAAAATGAAAAAAGG + Intergenic
1046792807 8:118340038-118340060 TTGAATAAATGAATGAACAAAGG - Intronic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1046857778 8:119053618-119053640 CTGGAGACACAAATGGAGAATGG - Intronic
1046955369 8:120057884-120057906 CTTCATAAACAAAGGGAGAAAGG - Intergenic
1047301762 8:123619484-123619506 TTCAGTATACAAATGGACAATGG - Intergenic
1047351654 8:124080110-124080132 ATGAATGACCAAATGAACAATGG + Intronic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047952339 8:129945237-129945259 ATGAATGAACAAATGGATTAGGG - Intronic
1048266526 8:132992099-132992121 ATGAATAAGCAACTGAACAAAGG - Intronic
1048409035 8:134152479-134152501 CTTACTAAACAAATAGAAAAGGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1048941301 8:139403070-139403092 CTGAATATATGAATGGACAGTGG + Intergenic
1049044111 8:140136149-140136171 CTTAAAAAAAAAATAGACAAGGG + Intronic
1049177706 8:141204348-141204370 CTGGATAAACGTATGGAAAAGGG + Intergenic
1049489297 8:142885443-142885465 CTGGATTAAAAAATGGACAAAGG - Intronic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051324622 9:15951689-15951711 CTGATTTAAAAAATGGGCAAAGG - Intronic
1051506371 9:17831636-17831658 CTGAATGAAAACAGGGACAATGG - Intergenic
1051875818 9:21792130-21792152 CTGATTTAAAAAATGGGCAAAGG + Intergenic
1051879538 9:21825963-21825985 CTGATTAAAAAAATAGGCAAAGG - Intronic
1052322030 9:27177789-27177811 CCTGATAAAAAAATGGACAAAGG - Intronic
1053436483 9:38078583-38078605 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054165558 9:61723835-61723857 CCCCATCAACAAATGGACAAAGG + Intergenic
1054918877 9:70522019-70522041 ATGAATGAACAAATGAATAATGG - Intergenic
1055222323 9:73951428-73951450 CTGCATTAATAAATGGGCAAAGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055858585 9:80722252-80722274 ATGAATGAACAAAAGAACAAAGG - Intergenic
1056602016 9:88053874-88053896 CTGAGTACACAAACAGACAATGG + Intergenic
1056627617 9:88266472-88266494 CTGAAAATGCAAATAGACAATGG + Intergenic
1056710492 9:88989112-88989134 CTCCATAAAAAAATGGAAAATGG + Intergenic
1057665532 9:97042099-97042121 CTGAGTAAACAAATAGACAATGG - Intergenic
1057926953 9:99161077-99161099 GAGAATAAACAAATGAATAAAGG - Intergenic
1058319637 9:103612851-103612873 CTGATTTAAAAAATGGGCAAAGG - Intergenic
1058713097 9:107698165-107698187 CTGAAAAAAGAAATGGAGAGAGG + Intergenic
1058847878 9:108979932-108979954 CTGAATTAACAAAGGAAAAATGG - Intronic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059207926 9:112483985-112484007 CTTAAAAAACACATGCACAAAGG - Intronic
1059968209 9:119637227-119637249 TTGAATATATAAATGGAAAATGG - Intergenic
1060423809 9:123488176-123488198 TGGAGTAAACACATGGACAATGG + Intronic
1060566807 9:124599904-124599926 TTGAATAAACATATGGGAAATGG - Intronic
1060862620 9:126967356-126967378 CTGAAAAAAGAAAAGGACAGAGG - Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1186331886 X:8543142-8543164 ATGAATAAATAAGTGAACAAAGG + Intronic
1187326886 X:18299209-18299231 CTTAATTAAAAAGTGGACAAAGG + Intronic
1187464894 X:19518312-19518334 CTCAATTAAAAAATGGGCAAAGG - Intergenic
1187492980 X:19769991-19770013 CTGAATCTAAAAATGGGCAAAGG + Intronic
1187550465 X:20297877-20297899 CTCAATATAAAAATGGGCAAAGG + Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1188904367 X:35774424-35774446 ATAAATAAACAAATAGGCAAAGG - Intergenic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1189855659 X:45222826-45222848 CTCAATTAACAAGTGGGCAAAGG - Intergenic
1189954762 X:46266214-46266236 CTAAATAAGAAAATGGCCAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1190149404 X:47931364-47931386 CTGAATAAACAAATAAGCAGGGG - Intronic
1190473506 X:50806073-50806095 ATGAATGAACAAAGGGGCAATGG + Intronic
1190483504 X:50901015-50901037 ATGAACAAACAAATGCACAAAGG + Intergenic
1190748289 X:53339857-53339879 CTGAACGTACAAATTGACAATGG + Intergenic
1191017103 X:55820457-55820479 CCTCATTAACAAATGGACAAAGG - Intergenic
1191024812 X:55902463-55902485 CTCAATATAAAAATGGGCAAAGG - Intergenic
1191744571 X:64472253-64472275 CAGAATAAACAAATCTATAACGG - Intergenic
1191822045 X:65321206-65321228 CTCAATTAAAAAGTGGACAAAGG + Intergenic
1192065200 X:67877643-67877665 ATGATTTAAAAAATGGACAAAGG + Intergenic
1192808573 X:74530668-74530690 CTGAGTAAGCAAAAGGCCAAGGG + Intronic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193057068 X:77164153-77164175 TTAAATAAAGAAATGGACAAAGG + Intergenic
1193556839 X:82964221-82964243 CTGAATCAAAAAATGGGCAGAGG - Intergenic
1193840504 X:86403349-86403371 CTTCATTAAAAAATGGACAAAGG + Intronic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1194127250 X:90035165-90035187 CTGAATAATCAATGGGTCAAAGG - Intergenic
1194639265 X:96383102-96383124 CTGAATTAACAAAAGGAAGAAGG + Intergenic
1194826461 X:98570405-98570427 ATGAATCAGCAAATGGACCAAGG - Intergenic
1195012836 X:100750308-100750330 CTGATTAAAAAAATGGGTAAAGG - Intergenic
1195210481 X:102649595-102649617 CTGAATTAAGAAGTGGACACTGG - Intergenic
1195368947 X:104154156-104154178 CCTGATTAACAAATGGACAAAGG + Intronic
1195518958 X:105809615-105809637 CTCCATCAACAAGTGGACAAAGG - Intergenic
1195920936 X:109982960-109982982 CTCAATTAAAAAATGGGCAAAGG + Intergenic
1196159734 X:112469687-112469709 CTTAATAAACAAATGTAAGATGG + Intergenic
1196202559 X:112901919-112901941 CTCAGTAAACAAAATGACAAAGG - Intergenic
1196749597 X:119103258-119103280 CCCAATTAACAAATGGGCAAAGG + Intronic
1198171661 X:134112142-134112164 CCCAATTAACAAATGGGCAAAGG - Intergenic
1198514034 X:137386241-137386263 CTAAATTAAAAAATGGCCAATGG + Intergenic
1198805466 X:140490018-140490040 CTGAATAAACATACAGAAAATGG + Intergenic
1199205873 X:145147300-145147322 CCCAATTAAAAAATGGACAAAGG - Intergenic
1199556568 X:149115344-149115366 CTGACAAAACAAATGGGGAAAGG + Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1199702564 X:150393757-150393779 CTGATTAAACAATGGGCCAAAGG - Intronic
1200242197 X:154502810-154502832 CTGAAGGAACAAATGGAGGAAGG + Intergenic
1200291891 X:154883428-154883450 CCGAATTAAAAAATGGGCAAAGG + Intronic
1200338729 X:155379165-155379187 CCGAATTAAAAAATGGGCAAAGG + Intergenic
1200347740 X:155461527-155461549 CCGAATTAAAAAATGGGCAAAGG - Intergenic
1200425389 Y:3014742-3014764 ATGAATAAGCAAATGAACAGAGG - Intergenic
1200723471 Y:6634559-6634581 ATGAATTAATAAATAGACAAGGG + Intergenic
1201183341 Y:11371871-11371893 CTCAACAAAAAAATGGACAAAGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201430728 Y:13899476-13899498 ATGAATAAATAAGTGAACAAAGG - Intergenic
1201678664 Y:16617750-16617772 ATAAATAAACAAATAAACAATGG + Intergenic
1202251244 Y:22875713-22875735 CTGAATCAAAAAGTGGGCAAAGG + Intergenic
1202404232 Y:24509462-24509484 CTGAATCAAAAAGTGGGCAAAGG + Intergenic
1202466547 Y:25160620-25160642 CTGAATCAAAAAGTGGGCAAAGG - Intergenic