ID: 924273050

View in Genome Browser
Species Human (GRCh38)
Location 1:242354306-242354328
Sequence GGGTGGATCAATGCAAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 2, 1: 1, 2: 6, 3: 31, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924273050 Original CRISPR GGGTGGATCAATGCAAATTC AGG (reversed) Intronic
902153404 1:14463105-14463127 GGGTGGGTTAATGCAAATTGAGG + Intergenic
902260117 1:15218834-15218856 GGGTGGGTTAATGCAAATTGAGG - Intronic
902753424 1:18533267-18533289 GGATGGATAAATGGAAACTCAGG - Intergenic
905764939 1:40592499-40592521 GGGTGGGTTAATGCAAATTGAGG - Intergenic
906234412 1:44195870-44195892 GGGTGGACTAATGCCAATTGAGG - Intergenic
907026419 1:51124635-51124657 GAGTGGATCAATGCAAATGGAGG + Intronic
907353025 1:53849081-53849103 AGGTGGATCAGTGCAAATGTGGG + Intergenic
910057219 1:83047176-83047198 GGGGGTATAAATGTAAATTCTGG - Intergenic
910283589 1:85529027-85529049 AGGAGGATGAATGCAGATTCAGG + Intronic
914206426 1:145533963-145533985 AGGAGGATGAATGCAGATTCAGG - Intergenic
915795580 1:158730526-158730548 AGGTGGATCAGTGCAGATTTGGG - Intergenic
916945458 1:169721794-169721816 GGGTGAATGAATGCATATTTTGG - Intronic
917527934 1:175805791-175805813 GAATGGGCCAATGCAAATTCTGG + Intergenic
920624146 1:207579625-207579647 GAGTGGATCAATGCAGATTGAGG - Intronic
920636741 1:207711584-207711606 GGGCACATCAATGCAAATTGAGG - Intronic
921802405 1:219416615-219416637 AGGTTGATCAATGCAAATTGAGG + Intergenic
924273050 1:242354306-242354328 GGGTGGATCAATGCAAATTCAGG - Intronic
1063925783 10:10975946-10975968 GGGTGGGTCAATGGAAATTGAGG + Intergenic
1065869989 10:29947911-29947933 GGGTGGCTCAATGCAACTGATGG + Intergenic
1066711662 10:38242353-38242375 GGGTGGATCAATGCAAATTCAGG + Intergenic
1067808186 10:49407667-49407689 GGGTGGCTCTGTGCAACTTCAGG - Intergenic
1069946501 10:71989791-71989813 GACTGGATCCATGCAAATGCTGG - Intronic
1072102816 10:92245652-92245674 GGGTTGATCCTTGCAAATTTTGG - Intronic
1080956076 11:37097497-37097519 GGGCTGATTAATGCATATTCTGG + Intergenic
1087269974 11:96101092-96101114 AGCAGGAGCAATGCAAATTCAGG + Intronic
1091987118 12:4919727-4919749 GGATGAATCAATGCAAAGGCAGG - Intronic
1094475959 12:30840744-30840766 GGATGGGTCAATGCAAATTGAGG + Intergenic
1096017051 12:48286133-48286155 GGGTGGTTTAATGCAAATTGAGG + Intergenic
1102865064 12:116367844-116367866 GGGTGGATCACTACAAGGTCAGG - Intergenic
1105796262 13:23856509-23856531 GGGTGGGTTAATGCAAATTGGGG + Intronic
1106716961 13:32400421-32400443 GAGTGGATCACTGCAAAATTAGG - Intergenic
1108376820 13:49821749-49821771 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1109256963 13:60095430-60095452 GGGTGGGTCAATGTAAATTAAGG + Intronic
1110497055 13:76180350-76180372 GGGCAGATTAATGCAAATTGAGG - Intergenic
1111179599 13:84645781-84645803 GGGTGGATCAATGCAAATTGAGG + Intergenic
1112022133 13:95380718-95380740 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1112041380 13:95552178-95552200 GGAGGGATCATTGCAGATTCTGG - Intronic
1112583574 13:100697167-100697189 GAGTGGGTTAATGCAAATTTGGG + Intergenic
1112751485 13:102588329-102588351 GGGTGGGTTAATGCAAACTGAGG + Intergenic
1115245297 14:31288211-31288233 GGGAGGATCAATGCATATCTGGG + Intergenic
1117196284 14:53342957-53342979 GGGTGGCTCAATCCAACTTCTGG + Intergenic
1120246960 14:82018786-82018808 GGGAAGATCAATACAAATTTTGG - Intergenic
1120813730 14:88831303-88831325 GGGTGGGCCAATGCAAATTAGGG - Intronic
1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG + Intergenic
1129981172 15:79872616-79872638 GGGCAGGTCAATGCAAATTGAGG + Intronic
1130730530 15:86487468-86487490 GGCTGGATCAATGCATAATATGG + Intronic
1131357865 15:91761533-91761555 GAGAGGAACAATTCAAATTCAGG - Intergenic
1131746893 15:95458397-95458419 AGGTGGAAAAATGCAAATGCTGG - Intergenic
1131890722 15:96969162-96969184 AGGTGGATCAATGCAGATGTGGG + Intergenic
1134743113 16:16565773-16565795 GGGAGGTTCAATCCAAAGTCTGG + Intergenic
1134880258 16:17740024-17740046 CGGTGGATCCATGCTTATTCTGG + Intergenic
1134924447 16:18146687-18146709 GGGAGGTTCAATCCAAAGTCTGG - Intergenic
1138184113 16:54963341-54963363 GGATGGATCAATGAAAATCAAGG - Intergenic
1139102900 16:63789611-63789633 GGGATGATCAATGCAAATTGTGG + Intergenic
1142158017 16:88541555-88541577 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1142295607 16:89219725-89219747 GTGTGGATCAGTGCACATTCAGG - Intronic
1144303056 17:13941310-13941332 AGGTGAGTCAATGCAAATTGAGG + Intergenic
1144424856 17:15132285-15132307 GGGTGGGTCAATTCAAATTGAGG - Intergenic
1145834148 17:27941081-27941103 GGCTGGATCACTCCAAAATCAGG + Intergenic
1150366507 17:64591121-64591143 GGTTGGATTTATGCAAACTCGGG - Exonic
1155523941 18:26697561-26697583 GGGTGGGTCAATGCAATTTGAGG + Intergenic
1156032341 18:32726919-32726941 GGATGGAACAATGCAAATCCAGG - Intronic
1158518308 18:58149006-58149028 GGTTGAAACAATGCAAATCCTGG + Intronic
1159108474 18:64029312-64029334 GAGTGGGTTAATGCAAATTGAGG + Intergenic
1159246992 18:65819232-65819254 GAGTGGGTCAATGCAGATTGAGG - Intronic
1159337062 18:67081956-67081978 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1159337072 18:67082029-67082051 GGGTGAGCCAATGCAAATTGAGG - Intergenic
1162001767 19:7749111-7749133 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1166513337 19:43426206-43426228 GTGTGGATTAATGCAAATTAAGG - Intergenic
926855075 2:17246942-17246964 AGGTGGATTAATGTAATTTCTGG + Intergenic
930863709 2:56102497-56102519 GGGTGGGCCAATGCAAATTGAGG - Intergenic
931066297 2:58591435-58591457 GGGTGGACAAATGCAAGTACTGG + Intergenic
933486888 2:82935445-82935467 GGGTGGGTCAATGCAAATTGAGG - Intergenic
935120316 2:100178395-100178417 GGGTGGGCCAATGCAAATCAAGG - Intergenic
935694552 2:105760314-105760336 CTGTGGAGAAATGCAAATTCCGG + Intronic
936035179 2:109105406-109105428 GGGAGAAGCAATGCAAATCCTGG + Intergenic
948583919 2:239006693-239006715 GGTTGGGTCAATGGTAATTCGGG - Intergenic
1169633703 20:7663542-7663564 GGTTGGATCATTGCAAGTTCTGG + Intergenic
1169955307 20:11096390-11096412 GGGAGGAGCCATGCAGATTCTGG + Intergenic
1170478788 20:16744448-16744470 GGGAGGCTCAATACAAATTGAGG + Intergenic
1173891978 20:46519782-46519804 GAGTGGATCAATGCAAATTGAGG - Intergenic
1177355761 21:20004702-20004724 GGATGAGTCAATGCAAATTGAGG - Intergenic
1177806628 21:25881493-25881515 GTGTGGATTAATTCAAGTTCAGG + Exonic
1178042340 21:28653003-28653025 GGGAGGGTTAATGCAAATTGAGG - Intergenic
1185242915 22:49755981-49756003 GGATGGGCCAATGCAAATTGAGG - Intergenic
1185282060 22:49976461-49976483 GGGTGGATCACTGAAATTGCTGG - Intergenic
950793306 3:15490778-15490800 GGTTGGATCAATTTACATTCTGG - Intronic
953004416 3:38964821-38964843 GTGTGAATCAATACAAATTTAGG - Intergenic
963921897 3:150913775-150913797 GGTTAGATCAAGGCAAATTGTGG + Intronic
964026762 3:152083259-152083281 GGTTGGATAAATGCAAAGCCAGG + Intergenic
965717491 3:171622011-171622033 GAGTGGATAAATGAATATTCAGG + Intronic
965791273 3:172390625-172390647 GGATGTAGCCATGCAAATTCTGG + Intronic
968943805 4:3653272-3653294 GGGGGCATCAAAGCAGATTCTGG - Intergenic
970666904 4:18347156-18347178 GGGTGGATCAACTCAAGGTCAGG + Intergenic
971156814 4:24091970-24091992 TGGCAGAACAATGCAAATTCTGG - Intergenic
972441653 4:39099383-39099405 GGGGAGATCAATGCATATTGAGG - Intronic
974744385 4:66051866-66051888 AGGTGGAGCAATGTGAATTCTGG - Intergenic
974836422 4:67256658-67256680 GGGTGGGTCAATGCAAATTAAGG + Intergenic
974836423 4:67256680-67256702 GAGTAGTTCAATGCAAATTTAGG + Intergenic
978340397 4:107716398-107716420 GGCTGGAGCTATGGAAATTCAGG + Intronic
981652466 4:147075512-147075534 GGATGGACCAATGCTCATTCTGG - Intergenic
982376551 4:154697125-154697147 GGATGGATCAATCCACATTTGGG + Intronic
984385573 4:179052988-179053010 GGGTGGCTCAGTACAAATTAGGG - Intergenic
988518065 5:31921951-31921973 GCCTGTAACAATGCAAATTCTGG - Intronic
988936640 5:36090059-36090081 GGGTGGCCCAATGCAAATTAAGG + Intergenic
990950067 5:61289780-61289802 GGCTGGAGAAATGCAAACTCTGG + Intergenic
991326110 5:65435263-65435285 GGGAGGATACATACAAATTCAGG + Intronic
997065446 5:130554186-130554208 GGGTGGGTCAATGCAAATTGAGG - Intergenic
1001347082 5:170913342-170913364 GGGTGGGTGAATGCAAATGATGG + Intronic
1002402561 5:178999266-178999288 GGGTGGTTCAGTGCACACTCAGG + Intergenic
1003043808 6:2714336-2714358 GGGTGAGTTAATGCAAATTGAGG - Intronic
1006199630 6:32276618-32276640 TGGTGGGTTAATGCAAATTGAGG + Intergenic
1007362757 6:41370626-41370648 GGGAGGGTCAATGGAAAGTCAGG - Intergenic
1008149302 6:47931134-47931156 GGGTGGATTAATGAACCTTCTGG - Intronic
1009370476 6:62894376-62894398 GTGTGGATTAATGCAAATTGAGG + Intergenic
1010675913 6:78742752-78742774 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1010865954 6:80976978-80977000 GGGCAGGTCAATGCAAATTGAGG - Intergenic
1010866606 6:80983337-80983359 GGGAAGGTCAATGCAAATTGAGG - Intergenic
1011412019 6:87075651-87075673 GGGTGGATCGCCTCAAATTCAGG + Intergenic
1011545406 6:88477438-88477460 GGGTGGGTTAATGCAAATCAAGG + Intergenic
1011663551 6:89614416-89614438 GGGTGGATCACTTCGAGTTCAGG + Intronic
1011791067 6:90899530-90899552 GACTGGATCAATTCAAATACAGG - Intergenic
1015482735 6:133731170-133731192 GGTGGGATCATTGCAAATGCCGG - Intergenic
1016687133 6:146894686-146894708 GGGTGGATGAATGCAATCTGTGG + Intergenic
1023507302 7:40913396-40913418 GGGTGGACTAATGGAAATTTGGG - Intergenic
1024208868 7:47186862-47186884 GGCTGGAGCAATGGAAAGTCAGG - Intergenic
1024747671 7:52427161-52427183 GGGTGGGTTAATGCAAATTGAGG - Intergenic
1028317910 7:89427065-89427087 GGGTGGGTCAATGCAAATTGGGG + Intergenic
1028557453 7:92138930-92138952 TGCTGGGACAATGCAAATTCAGG + Intronic
1034328320 7:150258386-150258408 GGGTCAATCAATGTCAATTCGGG - Intronic
1034764896 7:153711078-153711100 GGGTCAATCAATGTCAATTCGGG + Intergenic
1035170362 7:157014067-157014089 GGCTGGATCAATACAGATACTGG - Intergenic
1035611750 8:971066-971088 GGGAGTATGAATGAAAATTCAGG + Intergenic
1046310402 8:112428783-112428805 GGGTGGAATAATGAGAATTCAGG - Intronic
1050806266 9:9682523-9682545 GGGTAGATCAATGCAAGTGTGGG + Intronic
1055079494 9:72255226-72255248 GGGTGGGTGGATGCAAATTGAGG + Intronic
1055218216 9:73893986-73894008 GGGAGTATCAATGCAAATCATGG + Intergenic
1055343513 9:75310081-75310103 GGGGGGATCAATGCACACTCAGG - Intergenic
1056618663 9:88191445-88191467 GGGTGAATTAATGCAAATTAAGG + Intergenic
1061892156 9:133628228-133628250 GGATGCATCAATGCCATTTCTGG + Intergenic
1187789576 X:22935164-22935186 GGGTGGATCACGACAAAGTCAGG + Intergenic
1190364636 X:49680108-49680130 GGGTCAGTCAATGCAAATTGAGG + Intergenic
1190554767 X:51623081-51623103 GGGCAGGTCAATGCAAATTGAGG + Intergenic
1190628399 X:52359930-52359952 GGGCGGGTTAATGCAAATTTAGG - Intergenic
1190712218 X:53079177-53079199 GGATGGATAAATACAGATTCCGG - Exonic
1192152467 X:68720672-68720694 AGGTGGATCTAGGCAAATTCAGG - Intronic
1194152789 X:90345696-90345718 GGGGTGGTCAATGCAAATTGAGG + Intergenic
1195373931 X:104207065-104207087 GGGTGGGTTAATGCAAATTGAGG + Intergenic
1198200861 X:134417476-134417498 GGATGGATGAATGCTAATCCAGG - Intronic
1198606160 X:138340310-138340332 GGGTAGATAAATTCAAATTAAGG - Intergenic
1200499133 Y:3922441-3922463 GGGGTGGTCAATGCAAATTGAGG + Intergenic