ID: 924275488

View in Genome Browser
Species Human (GRCh38)
Location 1:242382003-242382025
Sequence TCTTGGAGTTAGAACTGGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924275488 Original CRISPR TCTTGGAGTTAGAACTGGAG AGG Intronic
902417986 1:16253570-16253592 TCTTTCAGTTAGGACGGGAGAGG - Intronic
903375902 1:22865845-22865867 TGCTGGAGTTAAGACTGGAGTGG - Intronic
903731225 1:25497088-25497110 TCTAGGAGTTAGACCGGGCGCGG + Intronic
904720377 1:32503258-32503280 TCTAGGAGCTAGAACTGCTGGGG - Intronic
906252151 1:44318939-44318961 TCTGGGAGTTAGAACTTGCAGGG + Intronic
907910610 1:58822704-58822726 ACTTTTATTTAGAACTGGAGGGG + Intergenic
908069545 1:60443095-60443117 CCTTTGAGTTAGAGCTGTAGTGG - Intergenic
908539064 1:65105366-65105388 CTTTGGAGTTGAAACTGGAGCGG + Intergenic
909045434 1:70703945-70703967 ACTTAGAGTTTGAGCTGGAGTGG - Intergenic
909393972 1:75149296-75149318 TGTTGGAGTTAAAGTTGGAGAGG + Intronic
910171795 1:84386005-84386027 TCTTGGAGATAGAGCTGGGCAGG + Intronic
912633301 1:111267810-111267832 TCTGGGAGCTAGAGCTGGAAAGG + Intergenic
912861735 1:113219569-113219591 TCTGGGAGTTGGACCTGCAGGGG + Intergenic
917615029 1:176733970-176733992 TCTTGGAGTGGGAGGTGGAGTGG - Intronic
921396011 1:214670351-214670373 TCTTGGATTTAGACCAGCAGAGG + Intergenic
921539084 1:216390870-216390892 TATTGAAATTAAAACTGGAGGGG + Intronic
921628234 1:217402244-217402266 TCCTGCAGTTAGGACTGGATTGG - Intergenic
924275488 1:242382003-242382025 TCTTGGAGTTAGAACTGGAGAGG + Intronic
1066309829 10:34185633-34185655 TCTTGGAGCTAAAACATGAGAGG - Intronic
1069810406 10:71155247-71155269 CCTTCAAGTTAGCACTGGAGAGG - Intergenic
1078483609 11:11701745-11701767 TCTTGGAGTTGGAACTTCTGAGG - Intergenic
1078852847 11:15179841-15179863 TATTGGAGTTAGTGGTGGAGAGG + Intronic
1080820681 11:35803315-35803337 ACTTAGACTTACAACTGGAGTGG - Intronic
1084738356 11:71120820-71120842 TGTTGGAGCTTGAATTGGAGGGG - Intronic
1085114551 11:73919200-73919222 TCAAGGAGTTTGAACTGGAGGGG - Intronic
1086417574 11:86604252-86604274 TGTTGGTGTTAAAGCTGGAGGGG + Intronic
1088812780 11:113402731-113402753 ATTTGGAGTTAGATCTGGAAGGG - Intergenic
1089329262 11:117678442-117678464 TCTTGGAGTTTACAGTGGAGGGG + Intronic
1090486668 11:127118762-127118784 TCTTGGTGGTAAAAGTGGAGAGG + Intergenic
1090777690 11:129979735-129979757 ACGTGCAGTTAGAACAGGAGGGG - Intronic
1091503251 12:1039848-1039870 TATGGGAGTAAGAAGTGGAGAGG + Intronic
1093278946 12:17166896-17166918 GACTGGAGTTAGAACTGGATAGG - Intergenic
1093570504 12:20661592-20661614 TCTTTCAGTGACAACTGGAGTGG - Intronic
1096678206 12:53236985-53237007 GCAGGGAGTAAGAACTGGAGAGG + Intergenic
1102217648 12:111172894-111172916 TCTTGGAGCTAAAGCTGGAAGGG - Intronic
1102566438 12:113800396-113800418 GCTGGGTGTTAGACCTGGAGTGG - Intergenic
1103975705 12:124701273-124701295 TCTAGGAGCTAAGACTGGAGTGG - Intergenic
1105285391 13:18999177-18999199 TCTGGGTGTTAGATATGGAGTGG + Intergenic
1106629025 13:31451380-31451402 TCTTAGAAAGAGAACTGGAGTGG + Intergenic
1108040651 13:46336812-46336834 TCATAGAGGTAGAACTGGAAAGG + Intergenic
1109825762 13:67719401-67719423 TCTAGGAGTAAGAACTAGAAGGG + Intergenic
1111119595 13:83829490-83829512 TCTTGGAGGTAGTAGTGGAAGGG - Intergenic
1116406895 14:44577753-44577775 TCTTGTGGATAGAACTTGAGTGG - Intergenic
1119441564 14:74631864-74631886 GCATGGTGTTAGAAGTGGAGGGG + Intergenic
1119665521 14:76482446-76482468 TCATGGAGCCAGAACAGGAGGGG + Intronic
1121333981 14:93065561-93065583 CCCTGGACTTAGAACTGGACAGG - Intronic
1122463895 14:101917529-101917551 ACGTGGAGTCAGAACTGCAGAGG + Intronic
1122909303 14:104819274-104819296 TCTTGTAGGTAGGACAGGAGAGG - Intergenic
1124236073 15:27990257-27990279 TCTGGGTGTTGGAACTAGAGGGG - Intronic
1125355007 15:38808169-38808191 TTTTGGAGTTCTAACTGTAGAGG + Intergenic
1125717190 15:41826052-41826074 TCTTGGAGGGAGAATGGGAGTGG - Exonic
1127816376 15:62612909-62612931 TCTTTGTGGTAGAACTGGAAAGG + Intronic
1129751392 15:78067235-78067257 TCCCAAAGTTAGAACTGGAGAGG - Intronic
1129979285 15:79851852-79851874 TCTTAGAGGTAGTACAGGAGAGG + Intronic
1130760629 15:86815767-86815789 TCTGGGAGGTAGAAGAGGAGAGG - Intronic
1132422541 15:101684713-101684735 GCTTGGAGCTAGAAGTGCAGAGG - Intronic
1134684709 16:16150474-16150496 GCTTCGGGTTAGAGCTGGAGGGG - Intronic
1142037803 16:87872706-87872728 TGTTGGTGTTAGTGCTGGAGAGG - Intergenic
1146767656 17:35538019-35538041 TCTCAGAAGTAGAACTGGAGAGG + Intergenic
1146958850 17:36955151-36955173 TCATGGAGTTAGAGTTGGAAGGG + Intronic
1147768518 17:42852280-42852302 CCTTGGGGATAGAACTGTAGAGG - Exonic
1148517076 17:48229763-48229785 TCTTGCTGTTATAATTGGAGAGG - Intronic
1148986051 17:51622256-51622278 CTTTGGAGTTAGAACTGTTGGGG + Intergenic
1149426463 17:56559126-56559148 TCTTGTAATTATGACTGGAGTGG - Intergenic
1149865102 17:60147203-60147225 ACATTGAGTTAGCACTGGAGAGG - Intergenic
1151865639 17:76800310-76800332 TCTTGGAGCTAGTACTGAAGTGG + Intergenic
1152845209 17:82595606-82595628 TCCTTGTGTTTGAACTGGAGAGG + Intronic
1153331795 18:3881347-3881369 TGTTAAAGATAGAACTGGAGAGG + Intronic
1153755391 18:8277417-8277439 TGCTTGAGTTAGCACTGGAGAGG + Intronic
1153820855 18:8830217-8830239 TGGTGGAGTTTTAACTGGAGAGG + Intronic
1156408428 18:36805178-36805200 GCTTGGAGGTAAAAATGGAGAGG + Intronic
1156849420 18:41708815-41708837 TTTTGGAGTTAGAAATAGAGAGG + Intergenic
1158393173 18:57059907-57059929 TCTGGGTGGTAGAACTGCAGGGG + Intergenic
1160732182 19:646295-646317 AGTTGGAGTTGGAGCTGGAGAGG - Intergenic
1165009423 19:32833070-32833092 TCTTGGAGTCAGGACAGGTGAGG + Intronic
1165009964 19:32838042-32838064 TCTTGGAGTCAGGACAGGTGAGG + Intronic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1167525282 19:49979685-49979707 TCACAGAGGTAGAACTGGAGGGG + Intronic
1167786671 19:51643433-51643455 ACCTGGAATTAGAACTGAAGTGG - Intronic
926941859 2:18146317-18146339 TCTAGTAAGTAGAACTGGAGTGG - Intronic
927131431 2:20063701-20063723 TCTGGGGGTAAGAACTGGGGAGG + Intergenic
930388436 2:50728749-50728771 TATTGGAGTCAGAACTAAAGTGG - Intronic
931922940 2:67040518-67040540 TCTTGGAGATAGACCAGCAGGGG - Intergenic
932140631 2:69274151-69274173 TCTTGAATTTAGAAGTGGAAAGG - Intergenic
933155076 2:78964399-78964421 TCTTGTACTTTGAACTGCAGAGG - Intergenic
935388888 2:102529893-102529915 ACTTGGTGTTATAACTAGAGAGG + Intronic
937276701 2:120689342-120689364 AATTGGACTTAGAACTGGTGTGG - Intergenic
938577427 2:132618056-132618078 TCTTGGAGTGGGAAATGGAGGGG - Intronic
939026892 2:137024865-137024887 TCTTGGAGTTAAAGCTGAAAGGG - Intronic
939842192 2:147202771-147202793 TCTTGGACTCAGCACTGCAGAGG + Intergenic
945548262 2:211185954-211185976 TCTTGGAGTAGGAAAAGGAGGGG - Intergenic
946300480 2:218820951-218820973 TCTTCGATTCAGAGCTGGAGTGG + Intergenic
948828839 2:240587495-240587517 TCTAGGTGTTACAACTGGAAAGG - Intronic
1168977828 20:1981255-1981277 TCTGGGAGTCAGACGTGGAGGGG - Intronic
1169614623 20:7426638-7426660 TCTTGGAGTTAAAACAAGACTGG - Intergenic
1170715385 20:18826648-18826670 TCTTGGGGATAAAACTGGGGTGG + Intronic
1172388202 20:34548448-34548470 AGGTGGAGTTAGAGCTGGAGAGG + Intronic
1174272259 20:49378165-49378187 TCATGGAGTTAGAAGTAGAAGGG + Intronic
1174588558 20:51627215-51627237 TCTAGGAGTTGAATCTGGAGAGG - Intronic
1179000425 21:37452595-37452617 TATTTGAGTTTGTACTGGAGAGG + Intronic
1179976545 21:44871447-44871469 TCTTGAAGTTAAACCTGGATAGG - Intronic
1181479140 22:23186794-23186816 TCTTGAAGCTTGAACTGGGGAGG - Intronic
1181596580 22:23918884-23918906 TCTGGCAGCTAAAACTGGAGAGG + Intergenic
1183784768 22:40023015-40023037 TCTTGGAGTTGGAACAGGCCTGG + Intronic
1184292737 22:43506721-43506743 TCTTTGAATTAGGACTGGAGGGG + Exonic
1185199886 22:49494790-49494812 TCTAGAAGTGAGAACTTGAGTGG - Intronic
949981264 3:9503141-9503163 TCTTTGGGTTAAAACTGAAGTGG + Intronic
950859867 3:16138267-16138289 TCTTGAAGACAGACCTGGAGAGG - Intergenic
951910721 3:27747758-27747780 TGGTGGTGTCAGAACTGGAGGGG + Intergenic
953666760 3:44931054-44931076 TCCTGGAGTTTGAAGTGTAGTGG - Intronic
953915243 3:46915257-46915279 GCTTGTAGTTAGCTCTGGAGTGG - Intergenic
957182165 3:76892858-76892880 ACTTGGAGAAAGAACTGGAAAGG - Intronic
961905899 3:130263115-130263137 TCTTTCATTTAGAACTGGCGGGG - Intergenic
964865560 3:161255934-161255956 TGTTGGAGTCAGCACTGCAGTGG + Intergenic
968672066 4:1857043-1857065 TCTTGGACTGGGAAGTGGAGCGG - Intergenic
972863350 4:43200030-43200052 GCTCAGATTTAGAACTGGAGAGG - Intergenic
976756589 4:88505112-88505134 TCTAGGAGTTAAGACTGGAAAGG - Intronic
981909040 4:149956495-149956517 TCTTGGAAATAGAACAGGGGAGG + Intergenic
982129475 4:152214954-152214976 TCTTGGAATTAGGGTTGGAGTGG - Intergenic
985935871 5:3097453-3097475 TCTTGGGGCTAGAAGAGGAGGGG - Intergenic
988057751 5:26122223-26122245 TTTTGGATGTAGAACTGGAGGGG + Intergenic
989133666 5:38131776-38131798 TCTGGGAATAAGAAATGGAGAGG - Intergenic
989996815 5:50844063-50844085 TATTGGAGTCTGAACTGGAACGG + Exonic
994507986 5:100665693-100665715 TCTTTGAGCTAGAGCTGGAGTGG + Intergenic
994584988 5:101695620-101695642 ACCAAGAGTTAGAACTGGAGAGG - Intergenic
994585042 5:101696698-101696720 ACCAAGAGTTAGAACTGGAGAGG + Intergenic
994853349 5:105085469-105085491 TCTTGGAGATAGATCTAGAGAGG - Intergenic
998302585 5:141039366-141039388 CCTTGGAGTTGGTATTGGAGAGG - Intergenic
998484533 5:142490239-142490261 ACTTAAAGTTAGAACTGAAGAGG - Intergenic
998543068 5:143001635-143001657 TCCTGGAGTCGGAAGTGGAGTGG + Intronic
999531621 5:152469184-152469206 CCCTGGAGTTAAAACTAGAGTGG + Intergenic
1001714661 5:173805499-173805521 TCCTGGATTCAGCACTGGAGAGG - Intergenic
1005566864 6:27104947-27104969 TCTTGTTGTCACAACTGGAGAGG + Intergenic
1007161761 6:39796939-39796961 TCACGGACTTAGAACTGGAGAGG - Intronic
1007302844 6:40881186-40881208 TTTTGGAGTAAGCACTGGGGAGG + Intergenic
1010182993 6:73109599-73109621 TTCTGGATTTAGAAATGGAGGGG + Intronic
1011797127 6:90968604-90968626 TCTTGGACTTATTCCTGGAGGGG + Intergenic
1013078210 6:106789590-106789612 ACTTGGAGTAAGAACTGATGAGG - Intergenic
1014306029 6:119743375-119743397 ACTTGGAGTTAGAGCTAGATAGG - Intergenic
1014837054 6:126171582-126171604 TCTTAGTGTGAGAACTGGGGAGG + Intergenic
1017684116 6:156894816-156894838 TCCTAGAGATAGAACTGGACTGG + Intronic
1024497758 7:50067874-50067896 AGTTAGAGTTAGAACTGGTGTGG + Intronic
1026934925 7:74248984-74249006 TCTTAGAGTCAGACCTGTAGGGG - Intronic
1027868719 7:83679002-83679024 TGCTGGAGTCAGTACTGGAGGGG + Intergenic
1028361841 7:89977227-89977249 GCTCAGAGTTAGGACTGGAGGGG - Intergenic
1029629614 7:101742356-101742378 TTTTGGAGTTAGAAAAGGGGAGG - Intergenic
1030068315 7:105677373-105677395 TCATGGAGTTACAACAGGACAGG + Intronic
1030791536 7:113735408-113735430 TCAGGAAGTTAGAACTAGAGGGG - Intergenic
1032461243 7:132113178-132113200 TCTTGGAGCTCGCACTGGAATGG - Intergenic
1034255652 7:149723311-149723333 TCTTGGAGTCAGACCCGGAGAGG + Intronic
1035328914 7:158083976-158083998 TCATGGAGTTAGACCTGTAGTGG - Intronic
1036101277 8:5788528-5788550 CCCTGGAGGTGGAACTGGAGTGG + Intergenic
1037662935 8:20942546-20942568 TTTTGGAGTTAGACCTGAATTGG + Intergenic
1042797838 8:72684104-72684126 CCTTGGAGTTAGAAAGGGATGGG + Intronic
1044919712 8:97155908-97155930 TGTGGGAGTTAGAACAAGAGAGG + Intergenic
1045424235 8:102047805-102047827 ATTTGGTTTTAGAACTGGAGGGG - Intronic
1046232278 8:111373507-111373529 TCTAGGAGGGAAAACTGGAGTGG + Intergenic
1047161496 8:122385613-122385635 GCATGATGTTAGAACTGGAGAGG + Intergenic
1047283511 8:123466138-123466160 TCTGAGAATTACAACTGGAGAGG + Intronic
1047847490 8:128823855-128823877 TCTTGGTGATATAAATGGAGTGG - Intergenic
1048457930 8:134594760-134594782 TCTGGGACTTAGAAGTGGTGTGG - Intronic
1050027133 9:1347082-1347104 ACTAAGAGTTAGAATTGGAGGGG + Intergenic
1055635205 9:78270641-78270663 TATTGGATATAGAACTGGATGGG - Intronic
1055776417 9:79771008-79771030 TCTTGGAGGTAGAGGTGGGGAGG + Intergenic
1060006500 9:120004813-120004835 TCTTTGAGTGAGAACAAGAGGGG - Intergenic
1060082701 9:120666279-120666301 TTTTGGACTTAGAACTTGAATGG - Intronic
1062727363 9:138083188-138083210 CCTAGGAGTTGGAACTAGAGCGG + Intronic
1186301671 X:8205851-8205873 CCCTGGAGTCAGAACTGGTGTGG - Intergenic
1189254993 X:39630982-39631004 TCTTGGAGGCAGAGCTGCAGGGG + Intergenic
1189611158 X:42737494-42737516 TCTGATAATTAGAACTGGAGTGG - Intergenic
1190239213 X:48644343-48644365 TCTTGGTGTAAGAATTGGTGTGG - Intergenic
1191841361 X:65515586-65515608 TCTTGGGGCAAGAACTGCAGGGG - Intronic
1195067907 X:101254224-101254246 TCTGGGAAGTTGAACTGGAGGGG - Intronic
1195733782 X:107992495-107992517 TCTAGTAGTTAGAAGAGGAGAGG + Intergenic
1196290528 X:113935410-113935432 TTTTGGAGTTATAACTGGATTGG - Intergenic
1196893584 X:120311757-120311779 TCTAGGATTTATAACTGGGGAGG + Intergenic
1198029302 X:132739324-132739346 TCATGGAGTTAGAACTTAAAAGG - Intronic
1199881517 X:151977218-151977240 TTTTGGAGATAAAGCTGGAGTGG + Intergenic
1201143096 Y:11044730-11044752 TGTTGGAGCTTGAATTGGAGGGG - Intergenic
1202020035 Y:20454642-20454664 TCTTGGAGTTAGCAGTGGACAGG - Intergenic