ID: 924278629

View in Genome Browser
Species Human (GRCh38)
Location 1:242413176-242413198
Sequence GGCTGGTCAGAGTGTCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 194}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924278629_924278634 20 Left 924278629 1:242413176-242413198 CCATGCTGACACTCTGACCAGCC 0: 1
1: 0
2: 2
3: 7
4: 194
Right 924278634 1:242413219-242413241 ATGCTCTTTCTTTTTGAGGTTGG 0: 1
1: 0
2: 7
3: 54
4: 628
924278629_924278633 16 Left 924278629 1:242413176-242413198 CCATGCTGACACTCTGACCAGCC 0: 1
1: 0
2: 2
3: 7
4: 194
Right 924278633 1:242413215-242413237 GAAAATGCTCTTTCTTTTTGAGG 0: 1
1: 0
2: 2
3: 54
4: 542

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924278629 Original CRISPR GGCTGGTCAGAGTGTCAGCA TGG (reversed) Intronic
900087109 1:904024-904046 GGCTGGGCACAGGGTCTGCAGGG - Intergenic
901317824 1:8320895-8320917 GGCTGGGCAGAGGGACAGAAAGG + Intronic
903931495 1:26864843-26864865 GGCGGGTCACAGTTTCATCAAGG + Intergenic
905018712 1:34794160-34794182 AGCACGTCAGTGTGTCAGCATGG - Intronic
907497526 1:54854784-54854806 GGGTGGTCAGGCTGTGAGCAAGG - Intronic
908097253 1:60751938-60751960 GGCAGGCCTGAGTGTCTGCAGGG - Intergenic
910677405 1:89828345-89828367 GGCTGGTGAAACTGTCATCAGGG - Intronic
915685365 1:157626747-157626769 GTGTGGTCAGAGTGTTAGGAGGG - Intergenic
919061691 1:192642023-192642045 GTGTGGCCAGAGTGTCATCAGGG - Intronic
921354710 1:214275166-214275188 GGCTGAACAGAGAGGCAGCATGG + Intergenic
922606260 1:226891652-226891674 AGCTGGTCAGAGTGTTACCAGGG - Intronic
924278629 1:242413176-242413198 GGCTGGTCAGAGTGTCAGCATGG - Intronic
1063241153 10:4170454-4170476 GGATGGACAGAGTCTCAACAGGG + Intergenic
1064120138 10:12611348-12611370 GGAACGTCAGAATGTCAGCACGG - Intronic
1064240850 10:13626956-13626978 GGCTGGACCCAGTGGCAGCAAGG - Intronic
1064646304 10:17463706-17463728 GGGTGCTCTGAGTATCAGCATGG - Intergenic
1064700337 10:18012463-18012485 GTCCAGTCAGAGGGTCAGCAAGG + Intronic
1066442055 10:35448724-35448746 GAGTGGTCAGAGAGGCAGCAGGG + Intronic
1070394175 10:75997700-75997722 AGGTGGTAAGAGTGCCAGCAAGG - Intronic
1070497464 10:77037679-77037701 TGTTGGTGAGGGTGTCAGCAGGG - Intronic
1070698072 10:78577765-78577787 GGCTGGTTGGAGTTTCACCAGGG - Intergenic
1070730752 10:78826661-78826683 GTAAGGTCAGAGTGGCAGCAGGG - Intergenic
1074439009 10:113458733-113458755 GGCTAGTCAGGATGCCAGCAGGG + Intergenic
1074829527 10:117239299-117239321 ATCAGGTCAGAATGTCAGCAGGG + Intergenic
1076559691 10:131353285-131353307 GGAGGGACAGAGTGGCAGCATGG + Intergenic
1076735348 10:132456540-132456562 GTGTGGCCAGAGTGTCCGCACGG + Intergenic
1077195720 11:1279037-1279059 GGCTGGAGAGAGTGGGAGCACGG - Intronic
1077815842 11:5684672-5684694 GGATGGGGAGAGAGTCAGCATGG + Intronic
1078267093 11:9763461-9763483 GGCTGGACAGAATGTGAACATGG + Intergenic
1081244896 11:40753127-40753149 GGCTGGGAAGAGTGTAAGGATGG + Intronic
1081569277 11:44279467-44279489 GGCTGGCTGGAGTGTCAGCATGG + Intronic
1083627923 11:64081453-64081475 GGATTGGCAGAGTGCCAGCAAGG + Intronic
1086295943 11:85368795-85368817 GGCTGGTTAGAGTTTCTCCAGGG - Intronic
1089109494 11:116043993-116044015 GGCTGGTGAGAGGGTCAGCAAGG - Intergenic
1089579188 11:119470896-119470918 GGCTGGTCTGACTGTCTGCTGGG - Intergenic
1091552443 12:1546755-1546777 GGCTTGTCAGTGTTTCGGCATGG + Intronic
1091800583 12:3322100-3322122 AGCTGCCCAGAGTGTCAGGAGGG - Intergenic
1093656920 12:21705604-21705626 GGCTGGGAAGAGTGTGTGCAGGG - Intronic
1096839498 12:54371611-54371633 GACTGGTCAGGGTGTAACCAAGG - Exonic
1101415051 12:104501583-104501605 GGGTGCTCAGAGTGTCGGCTTGG - Intronic
1104709804 12:130977548-130977570 GGCTGGTCCGGGTGCCAGAACGG + Intronic
1107727068 13:43309411-43309433 GGGTGGTAAGAGTGTTAGAATGG - Intronic
1109111860 13:58331019-58331041 GTAAGGTCAAAGTGTCAGCAGGG + Intergenic
1109143825 13:58751344-58751366 TCCAGGTCAGATTGTCAGCATGG - Intergenic
1114746721 14:25156344-25156366 GGCCTCTCAGAGTCTCAGCAAGG - Intergenic
1115254949 14:31390200-31390222 GACAGGTCAGAGTGTAAGGATGG + Intronic
1118081981 14:62371766-62371788 GGGAGATCAGAGTGCCAGCATGG + Intergenic
1120875371 14:89370534-89370556 TGCTGGGGAGACTGTCAGCATGG - Intronic
1121972032 14:98367178-98367200 GGCTGGTCAGGGAGTGAGCCTGG + Intergenic
1122160372 14:99780002-99780024 GTCTAGTCAGAGTGCCAGCATGG + Intronic
1123014050 14:105365168-105365190 GGGTGGTCTCAGGGTCAGCAGGG + Intronic
1127326750 15:57903304-57903326 AGGAGGTCAGAGTGTCAGGAAGG - Intergenic
1130052429 15:80495008-80495030 GGCTCTTCTGAGTGTCTGCAGGG + Intronic
1130104843 15:80921550-80921572 TGGTGGCCAGAGTGGCAGCACGG + Intronic
1130113845 15:80989377-80989399 GGCTGGAGCGAGGGTCAGCAGGG + Intronic
1131226027 15:90624855-90624877 GGGTGGCTAGAGAGTCAGCAGGG + Intronic
1132335266 15:101044364-101044386 GGCAGGGCACAGTGTCTGCACGG - Intronic
1132649225 16:1012967-1012989 GGCTGGTCTGGGAGTAAGCAGGG + Intergenic
1133004584 16:2872066-2872088 GGCTGCTCAGAGTCTGAGCCAGG - Intergenic
1134039996 16:11061030-11061052 GGCTGCTCTGAGTCACAGCAGGG + Intronic
1135734218 16:24917958-24917980 TGCTGGGCAGGATGTCAGCATGG + Intergenic
1135900812 16:26458128-26458150 GCCTGGTGAGGGTGACAGCATGG + Intergenic
1136394014 16:29983092-29983114 GGCTGGTCAGAGTCCCGGCCCGG - Exonic
1137223693 16:46481793-46481815 TCCTGGTCAGGCTGTCAGCAGGG - Intergenic
1137945609 16:52731017-52731039 AGCTTGTCAAAGTGTCAGCCAGG - Intergenic
1138089804 16:54164932-54164954 AGCTGGGCAGAGTCTCAGCCAGG - Intergenic
1138333125 16:56231169-56231191 GGCTGGGCTGAGTCTGAGCATGG - Intronic
1139380862 16:66529806-66529828 GGATGGACAGAGGGACAGCAGGG - Intronic
1140320608 16:73947919-73947941 GGCTGGTGAAAGTTTCATCATGG - Intergenic
1140859463 16:79006340-79006362 AGCAGGTTAGAGTGTCTGCATGG + Intronic
1143165475 17:4895309-4895331 GGCAGGTCAGAGGCTCAGCCAGG - Intronic
1143322682 17:6078345-6078367 TGCTGGGCTGAGGGTCAGCAGGG + Intronic
1144465342 17:15492767-15492789 GGCTGATCAGAGAGCAAGCAGGG + Intronic
1144779294 17:17799828-17799850 GGCTGCTCAGAGGGGCTGCAGGG - Intronic
1145255469 17:21319859-21319881 GGCTGGGCAGAGCCTCAGCTGGG - Intergenic
1145321143 17:21768093-21768115 GGCTGGGCAGAGCCTCAGCTGGG + Intergenic
1146920152 17:36704683-36704705 GGCTGGGCAGAATGTCTGTAGGG - Intergenic
1147861958 17:43529057-43529079 GACTGGGGAGAGGGTCAGCAGGG - Intronic
1148722987 17:49768200-49768222 GGCAGATCAGAGGATCAGCAGGG + Intronic
1151767596 17:76140290-76140312 GGCTGGTCAGGCTGTCATCCAGG + Exonic
1151891134 17:76950991-76951013 GGCTGGATAGAGTGACAGCCTGG + Intergenic
1152764415 17:82128287-82128309 GGGTGGTAAGAGTGTTAGGAGGG - Intronic
1155140980 18:23044221-23044243 GGCAGGTAAGAGTGTGTGCAGGG - Intergenic
1156081615 18:33342540-33342562 TGCTGCTCAAAGTGTCAGCTTGG - Intronic
1157591766 18:48840585-48840607 GGCTGCCCAGGGTGTCAGTAGGG - Intronic
1157762285 18:50273823-50273845 GTCTGGTCAGAGTCTGAGGATGG - Exonic
1159864805 18:73691424-73691446 GGCTAGTCAGACAGTGAGCAGGG + Intergenic
1160735595 19:661027-661049 GGCTGGCCAGGGAGCCAGCATGG - Intronic
1161170208 19:2808693-2808715 CGGAGGTCACAGTGTCAGCAGGG + Intronic
1161287878 19:3478202-3478224 GGCTGGGGACAGTGTCAGGAAGG + Intronic
1161652445 19:5493509-5493531 GGCTGGTCAGAGGGTCCAGATGG + Intergenic
1164912860 19:32026606-32026628 GGCTGGTGAGACTGGCAGGAAGG - Intergenic
1166896071 19:46022611-46022633 AGCTGCTCAGGGTGTCAGCCAGG + Intronic
1168508842 19:56958538-56958560 GCCTGCTCAGACTGTCACCATGG - Intergenic
927843329 2:26458617-26458639 GGCTGCTCAGACCCTCAGCAGGG - Intronic
931291471 2:60877771-60877793 GCCTCTTCAGAGTGTCATCAAGG - Intergenic
932892316 2:75607763-75607785 GGCTTGTCAGACTTTCTGCAGGG + Intergenic
935561408 2:104563667-104563689 GGCTGGTCAGAGGTTCCCCAGGG + Intergenic
937290299 2:120777907-120777929 GTGTGGTCAGAGTGGGAGCACGG + Intronic
937378376 2:121353501-121353523 GGCTGGGCAGGGTGTGGGCAGGG - Intronic
937754219 2:125516208-125516230 GGGTGGTGAGACTTTCAGCAAGG + Intergenic
947927648 2:233935732-233935754 GATTGGTCAGAGAGACAGCAGGG + Intronic
1168976823 20:1973003-1973025 GGCTGGGCAGAGACACAGCAGGG - Intergenic
1170585106 20:17728478-17728500 GGCTGGTAAGAGTTTGAGAAGGG - Intronic
1171234738 20:23515017-23515039 GGGTGGTGAGGGTGACAGCAGGG + Intergenic
1172271043 20:33656115-33656137 GACTGGCCAGGGTGCCAGCAGGG + Intergenic
1172392455 20:34575086-34575108 GGCAGGTAAGAGGGACAGCATGG - Exonic
1172618346 20:36304977-36304999 GTTTGGGCAGGGTGTCAGCAAGG - Intergenic
1173149833 20:40557545-40557567 GGCTCCTCAAGGTGTCAGCAGGG + Intergenic
1173856197 20:46252021-46252043 GGCTGGAGAGATTGTCAGCCAGG - Intronic
1174109672 20:48189964-48189986 GGCTGCTCATAGAGTCAGGAGGG + Intergenic
1174340666 20:49893107-49893129 TGCTGAGCAGAGTGTCAGCTGGG + Intergenic
1175804090 20:61817720-61817742 GCCTGGACAGTGGGTCAGCAAGG + Intronic
1177526165 21:22293067-22293089 GGCTGGTCGTAGTGCAAGCATGG - Intergenic
1178013675 21:28317725-28317747 GGCTGCTCAGAGTGGCAGTGGGG - Intergenic
1180915119 22:19480284-19480306 GGGCGGGCAGAGTGTCAGGATGG + Intronic
1183453763 22:37910576-37910598 GCCTGGTCAGAGTGGCAAAAAGG + Intronic
1183538707 22:38417539-38417561 GGGTGGGCAGAGTGGCAGCCTGG - Intergenic
1183632412 22:39041204-39041226 GGCGGGGGAGAGTCTCAGCAGGG - Intronic
1184218121 22:43080792-43080814 GGCAGTTCTGAGTGCCAGCAAGG - Intronic
1184452819 22:44592959-44592981 GGATGGGCAGAGGGACAGCACGG - Intergenic
950594389 3:13965965-13965987 GGCAGTTCAGATTCTCAGCAGGG + Intronic
950818119 3:15729023-15729045 GGCTGGTCACTGTGCCAGAAAGG + Intronic
953170264 3:40500622-40500644 GGCAGCTTAGAGTGGCAGCAGGG + Intergenic
953320130 3:41963971-41963993 ACCTGGGCACAGTGTCAGCAGGG - Intergenic
954420896 3:50418542-50418564 GGCCGGTCAGGGTGTCCTCAGGG + Intronic
954460025 3:50621082-50621104 GGCTGGGCAGGATGTCAGGAGGG - Intronic
955135059 3:56209112-56209134 GGCTGGGCAGAGTGGCAAAAAGG - Intronic
955473876 3:59315167-59315189 GGATGGTAAGAGTGACAGTAAGG - Intergenic
955690886 3:61589664-61589686 GACTGGTCTGCGTGTCAGGATGG + Intronic
957347237 3:78977812-78977834 GACTGGTGAGAGTTTCAGTAAGG - Intronic
957952695 3:87145832-87145854 GGCTGGTTAGAGTTTCTCCAGGG - Intergenic
958615902 3:96493602-96493624 TGCTGGTGTGAGTGTGAGCATGG - Intergenic
960594134 3:119392580-119392602 GGCTGGGCAGAGCCACAGCAGGG + Intronic
961090260 3:124104951-124104973 GGCAGGTCAGTGTATCAGGAAGG + Intronic
962969622 3:140386787-140386809 GCCTGTGCACAGTGTCAGCAGGG + Intronic
971629197 4:28967654-28967676 GGCTCATCAGTGTGTCAGTAGGG - Intergenic
972413125 4:38812801-38812823 CTGAGGTCAGAGTGTCAGCATGG - Intronic
974134992 4:57804032-57804054 GGGTGGGCAGAATGGCAGCAGGG + Intergenic
974386405 4:61205898-61205920 CTCTGATCTGAGTGTCAGCATGG + Intronic
974644108 4:64670933-64670955 GGCAGCTCCAAGTGTCAGCATGG + Intergenic
974675276 4:65080071-65080093 AGCTGGTCAGAGTTTCTCCAGGG - Intergenic
977475376 4:97500640-97500662 GGCTGGTCAGTGAGACAGGATGG + Intronic
979048335 4:115897802-115897824 GCTTGGTCACAGTGCCAGCAAGG + Intergenic
979951992 4:126904702-126904724 GGTTGGTCAGAGAGTTTGCAAGG - Intergenic
983164388 4:164457953-164457975 GGCTGGGAAGAGTGGCAGGAAGG + Intergenic
983321111 4:166198183-166198205 GGCTGGTTAGAGTTTCTCCAGGG - Intergenic
984685166 4:182659030-182659052 TGCTGGTCAGGAAGTCAGCAAGG + Intronic
985706633 5:1405363-1405385 GGCTGGTCCCGGAGTCAGCAGGG - Intronic
985759215 5:1736360-1736382 GTCGGGTCACAGAGTCAGCATGG - Intergenic
986208147 5:5645589-5645611 GGCAGGGCAGAGAGTCAGCTCGG - Intergenic
988566094 5:32320845-32320867 GGCAGGTGAGAGTGGCAACACGG + Intergenic
990457637 5:56003638-56003660 AGATGGTCAGATTTTCAGCACGG - Intergenic
996750611 5:126884799-126884821 GGGTGGCCAGAGTGGAAGCAGGG - Intronic
997400921 5:133601582-133601604 GGATGAACAGAGTGTGAGCAAGG + Intronic
997733230 5:136195382-136195404 CGCTGGTCATAGTGGCAGGACGG + Intergenic
999553601 5:152717504-152717526 GGCTGGTTGGAGTGTCTCCAGGG - Intergenic
1000864338 5:166493926-166493948 GGAGGGTCAGAGTGTCAGAGTGG - Intergenic
1001056728 5:168455767-168455789 GGCAGGGCAGAGTGTGAACAAGG - Intronic
1002122819 5:177018733-177018755 GGCTGTTCAGACCCTCAGCAGGG + Intronic
1007417551 6:41700850-41700872 GGCTGGTCAGACTGTTGGCCCGG + Intronic
1008071470 6:47103104-47103126 GGCTGCTCAGACTCTCAACAAGG + Intergenic
1008391046 6:50952230-50952252 AGCAAGTCAGAGTGGCAGCAGGG - Intergenic
1009621601 6:66084939-66084961 GTCTGGCTACAGTGTCAGCATGG + Intergenic
1010259086 6:73794747-73794769 GGCCGGTCATAGTGTCTGCATGG - Intronic
1011260915 6:85468827-85468849 GGCTGGTCAGAGTCCCAGCTGGG - Intronic
1016526023 6:145002531-145002553 GGCAGGTGAGAGAGACAGCAGGG + Intergenic
1017967854 6:159281889-159281911 GGCTGAACAGAGAGGCAGCATGG - Intergenic
1018050472 6:160004748-160004770 GCCTGGTGAGTGTGTGAGCATGG + Intronic
1018729872 6:166640657-166640679 GGCTGGTCCGATAGTAAGCAGGG + Intronic
1019522975 7:1468889-1468911 GGCTGGGCTGAGTGGAAGCAGGG - Intergenic
1020208895 7:6142931-6142953 GGCTGCTCAGAGTGTCAACAAGG + Exonic
1021828201 7:24574324-24574346 GGCTGGGTGGAGGGTCAGCAGGG + Intronic
1022537393 7:31106660-31106682 AGGTGGCCAGATTGTCAGCAGGG - Exonic
1027662584 7:81005344-81005366 GGCTGGTCAGAGTTTCTCCCTGG - Intergenic
1032474423 7:132202565-132202587 GGCTGGGCAGAGTTTCCACAGGG + Intronic
1033434901 7:141324295-141324317 GCCTGGGGAGAGTGACAGCAGGG + Intronic
1034980967 7:155476080-155476102 GGCTGGCCCTAGTGTCAGGAGGG - Intronic
1035126329 7:156610444-156610466 AGCTGGTCAGAGGCCCAGCACGG + Intergenic
1035253435 7:157611979-157612001 TGGAGGTCAGGGTGTCAGCAGGG - Intronic
1040611051 8:48982645-48982667 TGCTGGTCAGAATGTCCTCAGGG - Intergenic
1040909585 8:52504010-52504032 GGCTTCTCAGAGAGTCAGCATGG + Intergenic
1045406031 8:101867732-101867754 GGCTCATCAGAGATTCAGCAGGG - Intronic
1047609246 8:126504916-126504938 GGGTGGGCAGAGAGGCAGCAGGG - Intergenic
1049332903 8:142064682-142064704 GCCTGGTCACAGTTTCAGCGGGG + Intergenic
1049444321 8:142623082-142623104 GGCTGTTCTGAGACTCAGCAAGG - Intergenic
1049618163 8:143585428-143585450 GGCTGTCCCCAGTGTCAGCAAGG - Intronic
1050567466 9:6901207-6901229 GACTGGTGGGAGAGTCAGCAGGG + Intronic
1051401749 9:16691107-16691129 GGCTCCTCAGGGTGTCACCAGGG - Intronic
1055254102 9:74345526-74345548 GGATGATTAGAGTGTCAGAAAGG - Intergenic
1057441404 9:95086304-95086326 GGCAGGACACAGTGCCAGCAGGG + Intronic
1057503975 9:95617803-95617825 GGCTGGAAAGGGTGTCACCAAGG + Intergenic
1057699890 9:97356101-97356123 GCCTGGGCACAATGTCAGCAGGG + Intronic
1059833065 9:118120174-118120196 GGCTGGTCAGAGGTTCTCCAGGG - Intergenic
1061964128 9:134003654-134003676 GGATTGTCACAGTGTCAGGAGGG + Intergenic
1062572723 9:137193018-137193040 GTCTGGGCAGAGTGCCAGCTGGG + Intronic
1189255024 X:39631235-39631257 AGGAGGTGAGAGTGTCAGCAAGG + Intergenic
1193385933 X:80871693-80871715 GGCTGGGCATAGTGTGATCATGG + Intergenic
1197977662 X:132182672-132182694 GGGGGGTCAGAGTCTGAGCAGGG - Intergenic
1198710050 X:139491619-139491641 GAGTGATCAAAGTGTCAGCAGGG + Intergenic
1198733806 X:139764117-139764139 GGAAGGTGAGAGTGTCAGCAGGG - Intronic
1199734822 X:150675893-150675915 GGATGGTCAGAGAGTATGCAAGG + Intergenic
1201764250 Y:17564267-17564289 GGCGGGTCAGAGTCACCGCACGG - Intergenic
1201837303 Y:18341723-18341745 GGCGGGTCAGAGTCACCGCACGG + Intergenic