ID: 924281409

View in Genome Browser
Species Human (GRCh38)
Location 1:242440850-242440872
Sequence ACCTGATTTTAGAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 4, 3: 14, 4: 155}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924281409_924281416 28 Left 924281409 1:242440850-242440872 CCTTCACACTTCTAAAATCAGGT 0: 1
1: 0
2: 4
3: 14
4: 155
Right 924281416 1:242440901-242440923 AAATACAAAGAGAACTGGATTGG 0: 1
1: 0
2: 0
3: 69
4: 1149
924281409_924281410 2 Left 924281409 1:242440850-242440872 CCTTCACACTTCTAAAATCAGGT 0: 1
1: 0
2: 4
3: 14
4: 155
Right 924281410 1:242440875-242440897 TTCACCCCCTTGACACTGTATGG 0: 1
1: 0
2: 0
3: 8
4: 86
924281409_924281417 29 Left 924281409 1:242440850-242440872 CCTTCACACTTCTAAAATCAGGT 0: 1
1: 0
2: 4
3: 14
4: 155
Right 924281417 1:242440902-242440924 AATACAAAGAGAACTGGATTGGG 0: 1
1: 0
2: 4
3: 49
4: 612
924281409_924281415 23 Left 924281409 1:242440850-242440872 CCTTCACACTTCTAAAATCAGGT 0: 1
1: 0
2: 4
3: 14
4: 155
Right 924281415 1:242440896-242440918 GGATGAAATACAAAGAGAACTGG 0: 1
1: 0
2: 0
3: 28
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924281409 Original CRISPR ACCTGATTTTAGAAGTGTGA AGG (reversed) Intronic
902499774 1:16902390-16902412 ATCTGATTCTAGAAGAGTAAGGG + Intronic
909048488 1:70739319-70739341 GACGGATTTTGGAAGTGTGAAGG + Intergenic
911329325 1:96509007-96509029 AAAAGATTTTAGAATTGTGAAGG + Intergenic
911593354 1:99772846-99772868 ACCTGAATTTAGAATTTGGATGG - Intergenic
913195265 1:116451091-116451113 AGATGATTTTAGAAGTTTGGGGG - Intergenic
918374231 1:183892709-183892731 ACCTGCTTCTAGAAATATGAAGG + Intronic
920010271 1:202861898-202861920 ACCTGATTCGAAAAGTGTGTCGG + Intergenic
920932356 1:210400752-210400774 AGATGATTGTAGAACTGTGATGG + Intronic
923012655 1:230100668-230100690 ACCTGATTTTGTAAATGTGTAGG + Intronic
924281409 1:242440850-242440872 ACCTGATTTTAGAAGTGTGAAGG - Intronic
1064900065 10:20286599-20286621 AACTAATTTTAGAAGTTTCATGG + Exonic
1066630625 10:37456150-37456172 ACCTGTTTTTAGAGGACTGAAGG - Intergenic
1067699722 10:48561624-48561646 ACCTTATTATAGAATTTTGATGG - Intronic
1068520023 10:58067564-58067586 ATCTAATTTTTTAAGTGTGACGG - Intergenic
1069241747 10:66149589-66149611 ACTTTATTTTAAAAGTGTAAGGG - Intronic
1070499143 10:77054011-77054033 CCCTGGTTTGTGAAGTGTGAGGG - Intronic
1071066098 10:81638049-81638071 ACCTGTTTTCAGAAGTGTGGTGG + Intergenic
1071197907 10:83182896-83182918 ACCTAATTTTGGAAGTGGCATGG + Intergenic
1071460184 10:85886274-85886296 CCCTGATCTTTGCAGTGTGATGG - Intronic
1072303007 10:94079965-94079987 AGCTGATTTTACTATTGTGATGG + Intronic
1072551725 10:96483407-96483429 GCCTGATTTCAGAACTGTTATGG + Intronic
1074575718 10:114667250-114667272 ATCTGATTTTAGAAATGGGAAGG - Intronic
1078946161 11:16070852-16070874 GCCTCAGTCTAGAAGTGTGATGG - Intronic
1080555162 11:33409294-33409316 ATCAGATCTTAGAAGGGTGATGG + Intergenic
1081275161 11:41139608-41139630 CCCTGATTCTAGAAGTTTAATGG - Intronic
1092650974 12:10634516-10634538 CTCTGATTTTAGAATTATGAAGG - Intronic
1094358536 12:29604842-29604864 GCCTAATTTGAGAGGTGTGAAGG - Intronic
1095618870 12:44225210-44225232 ACTATATTTTAGAAGTGTGAGGG - Intronic
1098209935 12:68152761-68152783 ACCTAGTTTCAGAAGTGTGATGG - Intergenic
1099451625 12:82814917-82814939 ACCTGATTTTAGCTGTGTAGAGG + Intronic
1106150366 13:27094709-27094731 ATCTGATTTTAAAAAGGTGAGGG + Intronic
1107266647 13:38563458-38563480 TACTGACTTCAGAAGTGTGATGG + Intergenic
1107381723 13:39863670-39863692 ACCTGAGCTTGGAAGAGTGAAGG + Intergenic
1109874261 13:68378788-68378810 ACCTTATAAAAGAAGTGTGAGGG - Intergenic
1111097007 13:83529628-83529650 ACCTGATTCTAGATTTGAGAAGG - Intergenic
1114388479 14:22280412-22280434 ACCTGATTTTGGCTGTGTCAAGG - Intergenic
1114822248 14:26034657-26034679 TACTGATTTTACAAGTGTGGTGG - Intergenic
1116897655 14:50332879-50332901 AGCTGATTTTAGAAGGGTGAAGG - Exonic
1117076460 14:52109901-52109923 GCCTGATGTTAGAAGTGTGAGGG - Intergenic
1117731725 14:58729142-58729164 AACTGATTTTAAAAGTTTGGAGG + Intergenic
1121264638 14:92592464-92592486 TACTGATTTTGGAATTGTGAAGG - Intronic
1126693363 15:51305281-51305303 GCCTGAGTATAGAATTGTGAGGG + Intronic
1127005354 15:54562976-54562998 ACATGATTTCATAAGTGAGAAGG - Intronic
1129714854 15:77841073-77841095 ACTTGAGTAGAGAAGTGTGAGGG - Intergenic
1131115953 15:89795658-89795680 AGCTGAGTTTAGAAGTTTCAAGG - Intronic
1131117617 15:89804489-89804511 ACCTGATTTTGGGAGTGGGTAGG + Exonic
1131237359 15:90708481-90708503 AGCTGATTTTGGAAGAGTTACGG + Intergenic
1133094007 16:3428537-3428559 ACCAGATTTTTGAAGAATGAAGG - Intronic
1134909323 16:18009776-18009798 GCATGATTTCAAAAGTGTGATGG + Intergenic
1138984097 16:62305773-62305795 ACCTGGTCATAGAACTGTGATGG + Intergenic
1139576576 16:67846285-67846307 CCCTGACTGTAGAAGTTTGAGGG + Intronic
1141784952 16:86193310-86193332 ACTTGATGTTTGAAGGGTGAGGG + Intergenic
1144287290 17:13789195-13789217 TCCTGATATTATAACTGTGATGG - Intergenic
1144673969 17:17149868-17149890 ACCAGTTTTTAAGAGTGTGAAGG + Intronic
1145043314 17:19592932-19592954 ACCTGATTTAAGAAAAGGGAGGG - Intergenic
1145219406 17:21075937-21075959 ACCTGATTGTGGAGGTTTGAGGG - Intergenic
1146327369 17:31898565-31898587 AACTGATTTTAAATTTGTGAAGG + Intronic
1149779161 17:59382476-59382498 ATGTCATTTTAAAAGTGTGAAGG - Intronic
1149789185 17:59462526-59462548 AGCTAATTTTGGAAGTGTGAAGG + Intergenic
1151451739 17:74202244-74202266 GCCTAATTTTAGATGTCTGAAGG - Intergenic
1153083539 18:1256506-1256528 ACCTGATTTAAGAAGTCAGTAGG + Intergenic
1153359383 18:4176370-4176392 ACTTGGTTTTAGATGTGTGGAGG - Intronic
1154462563 18:14608519-14608541 ACCTGGTTTTAGTAAAGTGATGG - Intergenic
1159563036 18:70015961-70015983 CCCTCATTTTACAAATGTGAGGG + Intronic
1160330370 18:77986007-77986029 AGCGGATTTTTGTAGTGTGATGG + Intergenic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
927002535 2:18813110-18813132 AAATGATTTTAGAAGGATGAGGG + Intergenic
927091245 2:19714401-19714423 ACCTGATTTTTGAGGTAGGAAGG + Intergenic
928761489 2:34588305-34588327 ATGTGATTTGAGAAGTGTTATGG - Intergenic
929647584 2:43643831-43643853 ACTTGATTTTGGAAGCATGATGG - Intronic
929731811 2:44502769-44502791 AGCTGATTTTAGAAGAGAGAAGG + Intronic
930082113 2:47459308-47459330 ACCTGATTTTAGGTGTCTTAAGG - Intronic
930546707 2:52776642-52776664 ATTTGATTTGTGAAGTGTGAAGG - Intergenic
931179708 2:59887022-59887044 ACCTGATTTTGGAAGAGTTTTGG - Intergenic
931758746 2:65397576-65397598 AACAGATTGTAGAAATGTGAAGG - Intronic
931911223 2:66902336-66902358 ACCTGAATTTAGAGTTGGGATGG + Intergenic
931911369 2:66903618-66903640 ACCTGAATTTAGAGTTGGGATGG - Intergenic
932829634 2:74976722-74976744 ATCTGATATTAACAGTGTGAAGG + Intergenic
934532446 2:95102075-95102097 ACTTGAGTTTAGGAGTTTGAGGG + Intronic
939459516 2:142481566-142481588 AGCTGATTTTAGAGGGCTGATGG - Intergenic
940241249 2:151565551-151565573 TCCTAACTTTAGAAGTGTGGTGG - Exonic
940345195 2:152621415-152621437 ACTTGATTTTAAAAATGTGTTGG + Intronic
942857150 2:180562471-180562493 ACCTTATTATAGAAGTGGAAAGG - Intergenic
947352675 2:229262761-229262783 ACCTGATGTTAGAAGAGTCGAGG - Exonic
948359514 2:237409769-237409791 ACCGGATTTTAGAACTGTAAGGG - Intronic
1168734328 20:116787-116809 ACCTGCTGGTAGAAGTGTGTAGG + Intergenic
1171078122 20:22149677-22149699 TCCTGAGTTTACAAGTGGGAGGG - Intergenic
1173304884 20:41838693-41838715 ACCTGATTTTAGAAGTGCCATGG + Intergenic
1175483886 20:59330919-59330941 ACTTGAGTTTAGAACTGTGGTGG + Intergenic
1178542846 21:33469601-33469623 ACCTGATCTTGGAAGTGGCATGG - Intronic
1183569514 22:38642054-38642076 ACCTGAAATGAGAAGTCTGAAGG - Intronic
1185307758 22:50130815-50130837 AGCTGATTCTTGTAGTGTGAAGG + Intronic
949812581 3:8021619-8021641 AACTGATTTTAAAAATGTGGTGG - Intergenic
951457501 3:22908960-22908982 CTGTGATTTTGGAAGTGTGATGG - Intergenic
953364838 3:42335336-42335358 ACCTGTTTTTCAAAGTGAGATGG - Intergenic
955759396 3:62262292-62262314 GCCTCATTTTATAATTGTGAGGG - Intronic
956177884 3:66490539-66490561 ATCTGGTTTTAGCAGTGTGGTGG - Intronic
956660607 3:71593408-71593430 ATCTGATTTCAGAAGTGGGCAGG - Intergenic
956803076 3:72780803-72780825 GCCTGATTTTAGTCTTGTGATGG - Intronic
957152301 3:76501143-76501165 ACCAGATTTTATCAGTTTGAAGG + Intronic
958536218 3:95408046-95408068 ACCTGATTTTAGCTGAATGAAGG + Intergenic
959385113 3:105694565-105694587 ACATCATTTTAGAAATATGATGG - Intronic
959394266 3:105817054-105817076 ACATGTTTTTAGAATTATGAAGG + Intronic
960119081 3:113927980-113928002 GCCTCAGTTTAGAAGTGTGGGGG + Intronic
960127752 3:114018955-114018977 ATTTGTTTTTAAAAGTGTGAGGG - Intronic
962966711 3:140361972-140361994 ACCTGATTTTGGAAATGCAAAGG + Intronic
964384569 3:156133660-156133682 GTGTGATATTAGAAGTGTGAAGG + Intronic
964817368 3:160731142-160731164 ACCACATTTTTGGAGTGTGATGG - Intergenic
966529864 3:180964946-180964968 AGGTGATTTTAGAAGTTTGAGGG + Intronic
966593625 3:181706990-181707012 GTCAGATTTTGGAAGTGTGAAGG - Intergenic
966831576 3:184014329-184014351 TCCTGGGTATAGAAGTGTGAGGG - Exonic
970160162 4:13180194-13180216 ACCTGCTTTCAGAACTGTGAGGG - Intergenic
970178896 4:13367052-13367074 ACCTAATTTTAGAGGTGTAAGGG - Intronic
972995485 4:44873651-44873673 TCCTGTATTTAGAAATGTGATGG - Intergenic
975433500 4:74322864-74322886 ACCTAAATTTACAAGTGTCAAGG + Intergenic
978809375 4:112833337-112833359 ATCTGATTTTAGAGATGTCAGGG + Intronic
979209094 4:118078021-118078043 GCCTCAGTTTAGAAGTGTGGGGG + Intronic
979315489 4:119256769-119256791 AACAAATTTTAGAACTGTGAAGG + Intronic
979787673 4:124736572-124736594 ACCTGATTTTAGAATTTTATTGG + Intergenic
979928786 4:126603217-126603239 AACTAATTTTAGAAGTGGCATGG - Intergenic
982764189 4:159324592-159324614 AATTGATTTTAGAAGAGTCATGG + Intronic
984041251 4:174736651-174736673 ATTTGTTTATAGAAGTGTGAAGG + Intronic
985618915 5:942763-942785 AGCTGAAATTAGAAGTGTAATGG - Intergenic
985884178 5:2663633-2663655 CCCTGATTTAGGAAGTGTGTGGG - Intergenic
988325643 5:29763529-29763551 ACTGGATTTTAGAAGTATCACGG + Intergenic
993706412 5:91176791-91176813 ACCTAATTTTAGAACTGAGCAGG - Intergenic
994007734 5:94859738-94859760 ACGTGATGTTAGTAGAGTGATGG - Intronic
995689040 5:114802909-114802931 ACCTTATTTTAGCTGTGTTAGGG - Intergenic
996482420 5:123989799-123989821 AAATTATTTAAGAAGTGTGACGG - Intergenic
996946965 5:129081997-129082019 AGAGGATTTTAAAAGTGTGAGGG + Intergenic
999192862 5:149761883-149761905 ACCTGATTGTGGTACTGTGAGGG + Intronic
1000390895 5:160722326-160722348 CCCTGATTTTAGATGGGAGAAGG - Intronic
1001068177 5:168557090-168557112 ATGTGATTTTAGAAATGTTAAGG - Exonic
1005247054 6:23899042-23899064 ACATGATTTTACAGCTGTGATGG - Intergenic
1009341524 6:62560502-62560524 ACCTGAGTGTAGAAATGGGAAGG - Intergenic
1010641132 6:78329354-78329376 ACTTGATTTTAGAAGTGTGTTGG + Intergenic
1012302958 6:97612590-97612612 GCCTCACTTTAGAAGTGCGAGGG - Intergenic
1015267358 6:131302053-131302075 ACATCATTTTGGTAGTGTGATGG + Intergenic
1018378563 6:163236524-163236546 ATCTCATTTTAGAACTCTGATGG + Intronic
1018526169 6:164712030-164712052 ACCTTATTTAAGAAGTCTGTAGG + Intergenic
1027897999 7:84069854-84069876 ACCTTAATTTAGATGTGTGAAGG + Intronic
1028331790 7:89604057-89604079 TCCTGAATTGAGAAGTGTTATGG - Intergenic
1028573220 7:92315838-92315860 AACTAATTTGAGAAATGTGAAGG + Intronic
1030240280 7:107315294-107315316 ACCAGATTTTAAAAGTTTTAAGG - Intronic
1030863174 7:114663164-114663186 ACCTGTTTCTAGTTGTGTGAAGG - Intronic
1032544032 7:132727220-132727242 ACTTGAAATTAGAAGTGGGAGGG - Intronic
1032907511 7:136387477-136387499 ACATGATTTTATTAGTATGAGGG - Intergenic
1033406849 7:141078070-141078092 ACCTGATTTAAGACTTGTCATGG - Intronic
1033727818 7:144138944-144138966 GCCTCATTGTATAAGTGTGAAGG - Intergenic
1034717990 7:153261421-153261443 ACCAAATTTTAAAAATGTGAAGG - Intergenic
1035782671 8:2240815-2240837 AGCTGATTATAAAAATGTGAAGG - Intergenic
1035809452 8:2478774-2478796 AGCTGATTATAAAAATGTGAAGG + Intergenic
1041086198 8:54258868-54258890 ACCTGATTTTTGAAGGCTTAAGG + Intergenic
1041973479 8:63769857-63769879 AGCTGCTTTTACTAGTGTGAAGG + Intergenic
1042145314 8:65722256-65722278 GCCAGACTTTAGGAGTGTGAGGG - Intronic
1046291641 8:112169955-112169977 AACTGAATTAAGAAGTGTGGTGG + Intergenic
1051066643 9:13112234-13112256 CTCTGATTTTCTAAGTGTGAGGG + Intronic
1052802170 9:32978936-32978958 ATATGCTTTTAGTAGTGTGATGG - Intronic
1058403896 9:104649745-104649767 ACCTGATTTTAAAATGGGGAAGG + Intergenic
1058749406 9:108024127-108024149 ACCTGATTGTACAAAAGTGATGG - Intergenic
1060314985 9:122501169-122501191 ACATGATTATATAAATGTGATGG - Intergenic
1186871133 X:13774678-13774700 ACCCAAGTTTAGAAGTGTCATGG - Intronic
1187004680 X:15220394-15220416 CCCTGATTTTATAATTTTGAAGG - Intergenic
1187772246 X:22713052-22713074 AAATGATTTTAAAAGGGTGATGG + Intergenic
1187826273 X:23335213-23335235 ACCTGATCTTAAAGGTGAGAGGG + Exonic
1188850404 X:35125235-35125257 ACTTGATTTTTGAAATGTGAAGG + Intergenic
1188868152 X:35340167-35340189 CCCTGGTTTTATAAGTTTGATGG + Intergenic
1189582320 X:42419893-42419915 ACTTGATCTTAGAAGTATTATGG - Intergenic
1191031905 X:55982679-55982701 TCCTCATTTTACAAATGTGATGG - Intergenic
1194647500 X:96475302-96475324 TCCTGATTTTACAAGTGTGGAGG - Intergenic
1194932914 X:99910413-99910435 ACCTGATTGTAGAAATTTGGTGG + Intergenic
1196418607 X:115499747-115499769 GCTTGATTTTAGAACTGGGAAGG - Intergenic
1198006685 X:132501896-132501918 AGCTAATTTTAGCTGTGTGAAGG - Intergenic
1198888000 X:141360637-141360659 ACCTGTTTTTACAAATGTGAAGG - Intergenic