ID: 924282799

View in Genome Browser
Species Human (GRCh38)
Location 1:242454960-242454982
Sequence AGGGAGCCCCAGCACAATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924282793_924282799 1 Left 924282793 1:242454936-242454958 CCTGTTCTTCTTTTTTACCACAG 0: 1
1: 0
2: 4
3: 29
4: 399
Right 924282799 1:242454960-242454982 AGGGAGCCCCAGCACAATCAGGG 0: 1
1: 0
2: 1
3: 10
4: 152

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924282799 Original CRISPR AGGGAGCCCCAGCACAATCA GGG Intronic
901741495 1:11345027-11345049 AGGGAGCACTAGCACAAAGATGG + Intergenic
903189598 1:21649316-21649338 AGGGAGCCCCAGCCCAGCGAGGG + Intronic
905502410 1:38450238-38450260 AGGCAGCCCCTGAACCATCAAGG + Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
905932425 1:41798843-41798865 AAGGAGCCCCATCAGAAGCAGGG - Intronic
906662965 1:47595449-47595471 AGGAAGCCCCTCCACAAGCAGGG + Intergenic
909541288 1:76794292-76794314 AGGGTGCAGGAGCACAATCATGG + Intergenic
910261441 1:85297217-85297239 AGGGAGTGCCAGCATATTCAAGG + Intergenic
911836899 1:102630862-102630884 AGGAACATCCAGCACAATCAGGG - Intergenic
912554809 1:110508300-110508322 GGGGAGGCCCAGCAGAGTCAGGG + Intergenic
913517089 1:119613948-119613970 GGGGAGCCCCAGGACTGTCAGGG + Intergenic
914673583 1:149890513-149890535 AGGGGACCCCACCACAATCCTGG + Intronic
915292780 1:154897561-154897583 AGGGGGTCCCACCACAATCCTGG - Intergenic
915571391 1:156747070-156747092 AGGAAGGCCCAGCACAAACTGGG + Intronic
915648680 1:157292085-157292107 AGGCAGCCCCCCCAGAATCAAGG - Intergenic
915996932 1:160572960-160572982 AGGGTGCCCCAGCCCAATCCAGG - Intronic
917131677 1:171749505-171749527 AGAGGGCAGCAGCACAATCAGGG - Intergenic
920650077 1:207831148-207831170 AGTGAACCCCAGCACCAACAGGG + Intergenic
920786272 1:209044749-209044771 AGGCAGCCCCAGCTGAATCCAGG - Intergenic
923110816 1:230888607-230888629 AGAGAGACCCAGGACAACCACGG + Intergenic
924282799 1:242454960-242454982 AGGGAGCCCCAGCACAATCAGGG + Intronic
924475142 1:244376270-244376292 AAGAAGGCCCATCACAATCAAGG + Intronic
1067358837 10:45557801-45557823 AGGCAGCCCCATAACAATGATGG + Intronic
1067842000 10:49688547-49688569 AGGGGCCCCCAGCTCACTCAGGG + Intronic
1069655234 10:70083049-70083071 AGGGATTCCCAGCACCAACAGGG + Intronic
1071524529 10:86350475-86350497 TGGGAGGCCCAGCACATACAAGG + Intronic
1071604952 10:86979583-86979605 AGGGACCCCCAGGACATTGAGGG + Intronic
1077194326 11:1271919-1271941 AGGGACCCGCAGCACCAGCAGGG - Intergenic
1077288796 11:1779375-1779397 AGGGGCCCCCAACACAAGCAGGG + Intergenic
1078389761 11:10926740-10926762 AGGAAGCCCCATCAAATTCAAGG - Intergenic
1078520810 11:12061520-12061542 AGGGAGCCCTAACCCAATGACGG + Intergenic
1083513808 11:63236891-63236913 AGGGAGCCACAGCCCAGACAGGG - Intronic
1085677114 11:78533131-78533153 CTGGAGCCCCAGCACCAGCATGG + Intronic
1089079352 11:115762975-115762997 AAGGAGCCCCATCAAACTCAAGG - Intergenic
1091165912 11:133476030-133476052 AAGGACCACCAGCAAAATCATGG + Intronic
1091386224 12:97217-97239 ACTGAGCTCCAGCACATTCATGG - Intronic
1095714412 12:45326720-45326742 ATGGTGTCCCAGCACAATCTGGG - Intronic
1096257177 12:50070566-50070588 TGGGAGCCCCAGCAAAGACAAGG - Intronic
1096714545 12:53483120-53483142 AGGAAGCCCCACCCCACTCAGGG + Exonic
1097262666 12:57728228-57728250 AGGAAGCCCGAGCACATGCAGGG + Intronic
1101399490 12:104375254-104375276 AGAGTGCCCCAGCACCACCAAGG + Intergenic
1104689036 12:130810849-130810871 AGGGAGCCAAAGCACATTCTGGG - Intronic
1106220627 13:27743747-27743769 AGGGAGCACCAGGACAGTGACGG - Intergenic
1112221778 13:97498391-97498413 AGCCAGCCCCAGGAAAATCAGGG + Intergenic
1113183769 13:107662231-107662253 CGGGACCTCTAGCACAATCATGG - Intronic
1117589844 14:57255990-57256012 AGGGATCCCAAGCACAAACTGGG - Intronic
1117751046 14:58924185-58924207 AGGGAGGCCCTGCCCAATGAGGG - Intergenic
1118232871 14:63970237-63970259 AGAGTGCACCAGCACAATCATGG + Intronic
1118533614 14:66733183-66733205 AGAGAGACCTAGCACAAGCAGGG - Intronic
1119173066 14:72549382-72549404 AGTGAGCCCCAGCACAGCCAGGG + Intronic
1119612286 14:76073822-76073844 AGGGAGCAGCACAACAATCAAGG - Intronic
1119759764 14:77141921-77141943 AGGGCGCCCCAGCCCGCTCAAGG - Intronic
1120799126 14:88669516-88669538 AGGGAGGCCCCGCACAGTGAGGG - Intronic
1124199720 15:27668608-27668630 GGGCAGCCCCAGCGTAATCAAGG + Intergenic
1127927623 15:63562090-63562112 GGGGAGCCCCAGCACCATGGGGG - Intronic
1128216609 15:65938583-65938605 AGGCATCCCCAGCAGAAGCATGG - Intronic
1130919462 15:88332136-88332158 AGGAACCCACAGCACAATGAGGG + Intergenic
1132591368 16:727735-727757 AGGGAGCCCCAAGATAAACAAGG - Intronic
1132974494 16:2704663-2704685 ATGGAGCCCCAACACCACCAAGG - Intronic
1133223014 16:4327452-4327474 GGGGCGACCCAGCACACTCAGGG - Intronic
1133886138 16:9829539-9829561 AGGGACCACCAGCAAGATCATGG - Exonic
1138504692 16:57472413-57472435 AGGGAGCCTCAGCACCATGTGGG + Exonic
1143017104 17:3896701-3896723 TGGGAGCCCCAGCCAAATCCTGG - Exonic
1143658543 17:8311321-8311343 AGAGAGGCCCAGCACAGCCATGG - Intronic
1144600378 17:16607622-16607644 TGGGAGTCCCAGGACAATCCAGG - Intergenic
1144625545 17:16842681-16842703 AGGGAGCCCCCACAGAATAAAGG - Intergenic
1144880882 17:18430039-18430061 AGGGAGCCCCCACAGAATAAAGG + Intergenic
1145151350 17:20514348-20514370 AGGGAGCCCCCACAGAATAAAGG - Intergenic
1145982080 17:29018835-29018857 AGAGACCCCCTGCACAATCCTGG - Intronic
1146132607 17:30291875-30291897 AGCGAGCCGCAGCGCAATCCCGG - Exonic
1146162699 17:30568598-30568620 AGGGAGCCCCCACAGAATAAAGG - Intergenic
1152783841 17:82238036-82238058 CGCTAGCCCCAGCAGAATCAGGG - Intronic
1153619988 18:6968280-6968302 AGGGAGCCCTCGGAGAATCAGGG - Intronic
1153659676 18:7315802-7315824 TGGGAGCCCCTGCACCATAAGGG + Intergenic
1153767215 18:8385960-8385982 AGGAAGAGCCAGCACAATCCTGG + Intronic
1156520876 18:37721484-37721506 AGAGAGGCCCAGCCCACTCAAGG - Intergenic
1158667794 18:59448565-59448587 ACGGTTCCCCAGCACACTCAGGG + Intronic
1163643638 19:18476066-18476088 AGGGAGCCCCCACAAACTCATGG + Intronic
1165362328 19:35344653-35344675 AGGGAGGCCCAGAGCAAGCAGGG + Intronic
1166751381 19:45165360-45165382 AGGGAGCCCCAGCACCCTAGAGG - Intronic
925985958 2:9214877-9214899 AGGGAGCCATGGCACAAACAAGG - Intronic
928360907 2:30661630-30661652 ATGGAGTCACAGCCCAATCATGG - Intergenic
928797918 2:35046705-35046727 AGGGACCACCAGCACAATCCAGG - Intergenic
929116482 2:38448721-38448743 AGTGAGCCCCAGAAAAATCTGGG - Intergenic
934768184 2:96892257-96892279 AGGGAGCCCCAGGCCAAGGAGGG - Intronic
937499214 2:122460365-122460387 AGAGAACCCCAGGAAAATCAGGG + Intergenic
937985686 2:127637138-127637160 AGGGAGACCCAGCTCCAGCAGGG + Intronic
948428933 2:237906330-237906352 AGGGAGGCCCTGCACACTCAGGG + Intronic
1174722448 20:52827506-52827528 AGAGAGCCCCCACACCATCATGG - Intergenic
1178466375 21:32852247-32852269 GGGGAGCCCCAGCATAGTGACGG - Intergenic
1183579168 22:38713182-38713204 AGAGAACCCCAGCACAAGGAAGG + Intronic
1185138146 22:49085339-49085361 AGGGATGCCCAGCAGAAGCAGGG - Intergenic
1185400223 22:50611671-50611693 AGGGACCCCCGGCACAATTTCGG - Intronic
950220502 3:11191803-11191825 TGGGAGCCCCTGCACATTCCTGG + Intronic
950222654 3:11207811-11207833 AGGGAGCCACTGCAGGATCAAGG + Intronic
951807443 3:26661994-26662016 GAGGAGCCCCAGAACACTCAGGG - Intronic
952266764 3:31794474-31794496 TAGGAGCCTCAGCACAACCATGG - Intronic
953351817 3:42221669-42221691 TGGCAGCCCCAGCAAAATCCTGG + Intronic
954269718 3:49498168-49498190 AGGGAGCCCCAGGACCATCAGGG - Intronic
955094159 3:55781170-55781192 AGGCAGCCACAGCACAATGCAGG + Intronic
959027687 3:101259603-101259625 AGAAAACCGCAGCACAATCAAGG + Intronic
960269190 3:115656080-115656102 AGGTAGCCCCAGCTCTATCTGGG + Intronic
965136656 3:164781119-164781141 AATGACTCCCAGCACAATCATGG + Intergenic
965208631 3:165755081-165755103 AGGTAGCCCTAGCAGAAACAGGG - Intergenic
967123706 3:186406332-186406354 AGGGAGGCCCAGCACTGGCAGGG - Intergenic
969609873 4:8221010-8221032 AGGGATTCCCAGCACAAACAAGG + Intronic
969711919 4:8849602-8849624 CGGCAGCCCCAGGACACTCACGG + Intronic
977139382 4:93348618-93348640 AGGTAACCCCAGCACAGTCTGGG - Intronic
977789868 4:101087128-101087150 AGGTAGCCCCAGGACACTCCTGG - Intronic
980739586 4:136931923-136931945 AGGAAGCCACAGCACACTCTTGG - Intergenic
982574043 4:157085883-157085905 AGGGAGCCCCTTGAAAATCAAGG - Intronic
984745576 4:183212751-183212773 ATGGAGCCTCATCCCAATCAGGG + Intronic
986622564 5:9691137-9691159 AGGGGCCCCCAGCATAATCCAGG - Intronic
988683060 5:33502416-33502438 AGTAACCCTCAGCACAATCAGGG + Intergenic
990744490 5:58945031-58945053 AGGGAACCCCAGCAAAACCTTGG - Intergenic
998107128 5:139475795-139475817 GGGGAGCCCCAGCAGAAGAATGG - Intronic
1002703366 5:181142924-181142946 AGTGAGCCCCAGCGCCCTCATGG - Intergenic
1003099779 6:3168358-3168380 CGGGAGCCCCCGGACCATCACGG + Intergenic
1003265190 6:4559617-4559639 AGGGAGCCCCAGGGAAAGCAGGG - Intergenic
1004260080 6:14100464-14100486 AGTGGGCCCCAGCACCATCTGGG - Intergenic
1006465444 6:34191345-34191367 GGAGTGCACCAGCACAATCATGG - Intergenic
1006865790 6:37208115-37208137 AGGGCTCCCCACCACACTCAGGG - Intergenic
1008370128 6:50722522-50722544 AGGGAGCCTCAGAAGATTCAGGG - Intronic
1010336310 6:74687840-74687862 AGGGAGACGTAGCACTATCAAGG + Intergenic
1012576203 6:100802955-100802977 AGGGAGCAGTGGCACAATCAGGG - Intronic
1015052839 6:128863016-128863038 GGGGAGACCCAGCACATTCCCGG - Intergenic
1015658465 6:135546605-135546627 AGGGAGCCCCAGTTCCATCAAGG + Intergenic
1019171199 6:170134216-170134238 TGGGAGCCCCATCACATGCAGGG + Intergenic
1021058429 7:16079870-16079892 AGACAGCCACAGCACATTCAAGG + Intergenic
1023579141 7:41662968-41662990 GGGAAGCCCCAGCTCAATCCTGG - Intergenic
1024612909 7:51082460-51082482 AGAGAGCCCCATCTCAAACAGGG + Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1031187027 7:118494760-118494782 ATGGAGCACCTGCACAATCTTGG - Intergenic
1031595367 7:123643906-123643928 AGAGAGGCCCAGCACAACAATGG + Intergenic
1033038800 7:137899588-137899610 AGGAAGCCCCAGCAGACTAACGG + Intronic
1035010007 7:155706904-155706926 AGGGAGCGACAGCATAAACAAGG + Exonic
1035470423 7:159105673-159105695 AGGGAGCCCCAGCAGGGTCTGGG + Intronic
1035544356 8:468262-468284 AGGGAGCCCAAGCTGATTCAGGG + Intronic
1038799236 8:30734155-30734177 AGCGAGGCCCAGCACAATGAAGG + Intronic
1041758906 8:61342561-61342583 ATGCAGGCCCAGCACAAGCACGG - Intronic
1042878436 8:73461642-73461664 AGAGAGCACAAGCACAAGCACGG + Intronic
1045285980 8:100791901-100791923 AGGGAGCCTCATCACAAAAAAGG + Intergenic
1047756279 8:127921242-127921264 GGGGAGCACTAGCAGAATCAGGG + Intergenic
1047863710 8:128997827-128997849 AGTGATCCCCAGAACAATCCTGG - Intergenic
1048005985 8:130419685-130419707 AGGGAGCCCCAGCAGAAGACAGG + Intronic
1049782597 8:144435702-144435724 AGGGAGCCCCAGCACCCCCAGGG - Exonic
1051692637 9:19732663-19732685 AGGGAGAACCAGCACAGACACGG - Intronic
1052894168 9:33731766-33731788 AGGGAGGCCCAGGGCCATCAGGG - Intergenic
1054888339 9:70223654-70223676 AGGGTGCCCAAGTACATTCATGG - Intronic
1055176883 9:73329797-73329819 AGGGTACCTCAGCACAATAAAGG - Intergenic
1056794466 9:89648069-89648091 AGGGACCCACAGCACAGACAAGG - Intergenic
1056821177 9:89843106-89843128 AGGTAGCCCCAGCCAATTCAAGG - Intergenic
1058801964 9:108553013-108553035 AGGGACCCTCATCTCAATCAGGG + Intergenic
1059942432 9:119370734-119370756 AGGGAGGCCTAGAACAATCTAGG + Intergenic
1061854316 9:133433267-133433289 AGGGATCCCCAACACACACAGGG - Intronic
1062048347 9:134434686-134434708 AGGGAGCCCCAGCCCTTCCAGGG - Intronic
1062388509 9:136324789-136324811 AGTCAGCCCCAGCACACACAGGG - Intergenic
1189772626 X:44441641-44441663 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1189772944 X:44444323-44444345 AGGGTCTCCCAGCACCATCAAGG - Intergenic
1195703489 X:107722208-107722230 AGGGAGCCCAAGGAGAATCTTGG + Intronic
1196619629 X:117807241-117807263 AGGGAAGCCCAGCACTATAAAGG + Intergenic
1197762041 X:130034788-130034810 AGGCAGCCCCAGGGCAATCTGGG - Intronic
1199501386 X:148510496-148510518 ATAGAGCCCAAGCACAAGCAGGG - Intronic
1199967827 X:152834445-152834467 GGGTTGCCCCAGCATAATCAAGG + Intronic