ID: 924289434

View in Genome Browser
Species Human (GRCh38)
Location 1:242523622-242523644
Sequence GGCGCCGCTAGCGACCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 28}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924289434_924289436 11 Left 924289434 1:242523622-242523644 CCACGCTGGTCGCTAGCGGCGCC 0: 1
1: 0
2: 0
3: 0
4: 28
Right 924289436 1:242523656-242523678 TTCGTTAATTTGCTAGTTTTTGG 0: 1
1: 0
2: 1
3: 35
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924289434 Original CRISPR GGCGCCGCTAGCGACCAGCG TGG (reversed) Intronic
902067564 1:13700502-13700524 GGCGCCGCCACCCACCCGCGGGG - Intronic
905890581 1:41516270-41516292 GGTGGCGCTAGCGCCCAGCCTGG + Intronic
910430065 1:87151621-87151643 GGCGCTCCCAGCGACCAGGGGGG - Intronic
914950648 1:152110736-152110758 GGCGCCGCCAGCGACGCGAGAGG - Exonic
920120208 1:203650553-203650575 GGCTCAGCTGGCTACCAGCGCGG - Intronic
924289434 1:242523622-242523644 GGCGCCGCTAGCGACCAGCGTGG - Intronic
1069677015 10:70255550-70255572 GGCGCCGCTGGCGCTCATCGTGG - Exonic
1073412056 10:103350663-103350685 GACGCCGCTTGGGCCCAGCGGGG + Intronic
1097929711 12:65170118-65170140 GGCGCCCCTGGCCGCCAGCGAGG + Exonic
1105707334 13:22976584-22976606 GGAGCAGGTAGGGACCAGCGTGG + Intergenic
1112563253 13:100532252-100532274 GGAGCCGCCAGCGCCCACCGCGG - Exonic
1122486650 14:102086726-102086748 GGCGCCGCACGCGAACAGAGCGG - Intronic
1132885127 16:2179123-2179145 GGCGGGGCTGGCGCCCAGCGAGG + Exonic
1140222942 16:73057702-73057724 AGCGCCGCGAGCGCCCAGAGGGG - Intronic
1151830208 17:76544979-76545001 GGGGCTGCTGGCGGCCAGCGGGG + Intronic
1163311742 19:16519120-16519142 GGCACCGCTGGCCACCGGCGCGG + Exonic
1166546910 19:43639556-43639578 GGAGCCGGGAGCGACGAGCGGGG - Intronic
1168777759 20:462296-462318 GGCGCCGGGAGCGGCCTGCGAGG - Intronic
1171500000 20:25585743-25585765 GGCTCCGACAGGGACCAGCGAGG - Intergenic
1175847349 20:62065699-62065721 GTCGCAGCTGGCGGCCAGCGCGG - Exonic
1180875065 22:19171366-19171388 GGCGCCTCCCGGGACCAGCGGGG - Intergenic
1180970470 22:19812304-19812326 GGCACGGCAAGCGTCCAGCGTGG + Exonic
964478652 3:157120434-157120456 CGCGCCGCTGGCGACCCGCCTGG - Intergenic
967184110 3:186930744-186930766 GGAGCCGATACCGACCGGCGTGG + Exonic
968493286 4:901811-901833 GGCGCCGCTCCCGATTAGCGAGG + Intronic
1019686273 7:2383904-2383926 GGGGCAGCTAGCTCCCAGCGAGG - Intergenic
1025085012 7:56016480-56016502 GGCACCGCTATGGACCAGAGAGG + Intronic
1025124187 7:56331619-56331641 GGCACCGCTATGGACCAGAGAGG + Intergenic
1029168936 7:98617467-98617489 GGCGCTGCTGGCCGCCAGCGTGG + Exonic