ID: 924290819

View in Genome Browser
Species Human (GRCh38)
Location 1:242534619-242534641
Sequence ACATCAGGACTATACTGGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924290819_924290822 -7 Left 924290819 1:242534619-242534641 CCTTTCCAGTATAGTCCTGATGT No data
Right 924290822 1:242534635-242534657 CTGATGTTTTGTTCTTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924290819 Original CRISPR ACATCAGGACTATACTGGAA AGG (reversed) Intergenic
No off target data available for this crispr