ID: 924291790

View in Genome Browser
Species Human (GRCh38)
Location 1:242543875-242543897
Sequence CACCTGTAATTGCTTGAGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924291783_924291790 23 Left 924291783 1:242543829-242543851 CCCATCTCTATTAAAAATACAAA 0: 3464
1: 98202
2: 245798
3: 150953
4: 76280
Right 924291790 1:242543875-242543897 CACCTGTAATTGCTTGAGCTTGG No data
924291784_924291790 22 Left 924291784 1:242543830-242543852 CCATCTCTATTAAAAATACAAAA 0: 7209
1: 204891
2: 138561
3: 62527
4: 43378
Right 924291790 1:242543875-242543897 CACCTGTAATTGCTTGAGCTTGG No data
924291789_924291790 -6 Left 924291789 1:242543858-242543880 CCAGGTGTGGTGGCAGGCACCTG 0: 1658
1: 10332
2: 32338
3: 70730
4: 116623
Right 924291790 1:242543875-242543897 CACCTGTAATTGCTTGAGCTTGG No data
924291782_924291790 24 Left 924291782 1:242543828-242543850 CCCCATCTCTATTAAAAATACAA 0: 3239
1: 90474
2: 177241
3: 171619
4: 105611
Right 924291790 1:242543875-242543897 CACCTGTAATTGCTTGAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924291790 Original CRISPR CACCTGTAATTGCTTGAGCT TGG Intergenic
No off target data available for this crispr