ID: 924292593

View in Genome Browser
Species Human (GRCh38)
Location 1:242553081-242553103
Sequence GATACAGATGTGGATCCTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924292585_924292593 24 Left 924292585 1:242553034-242553056 CCCCTTAAAGTTCTATTTTATCT No data
Right 924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG No data
924292587_924292593 22 Left 924292587 1:242553036-242553058 CCTTAAAGTTCTATTTTATCTTT No data
Right 924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG No data
924292586_924292593 23 Left 924292586 1:242553035-242553057 CCCTTAAAGTTCTATTTTATCTT No data
Right 924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG No data
924292591_924292593 -3 Left 924292591 1:242553061-242553083 CCAAAATGTTAAGACTTGGGGAT No data
Right 924292593 1:242553081-242553103 GATACAGATGTGGATCCTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924292593 Original CRISPR GATACAGATGTGGATCCTTG TGG Intergenic
No off target data available for this crispr