ID: 924299277

View in Genome Browser
Species Human (GRCh38)
Location 1:242620813-242620835
Sequence CTCCTCATGGACAATGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924299277_924299287 23 Left 924299277 1:242620813-242620835 CCCTCCACATTGTCCATGAGGAG No data
Right 924299287 1:242620859-242620881 AAAGAGCCTTTCATCAATGGAGG No data
924299277_924299282 0 Left 924299277 1:242620813-242620835 CCCTCCACATTGTCCATGAGGAG No data
Right 924299282 1:242620836-242620858 GAGCTACTTTTTTTCCCTCCAGG No data
924299277_924299286 20 Left 924299277 1:242620813-242620835 CCCTCCACATTGTCCATGAGGAG No data
Right 924299286 1:242620856-242620878 AGGAAAGAGCCTTTCATCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924299277 Original CRISPR CTCCTCATGGACAATGTGGA GGG (reversed) Intergenic
No off target data available for this crispr