ID: 924304142

View in Genome Browser
Species Human (GRCh38)
Location 1:242670104-242670126
Sequence ATCTAAAAGCTAGTTCTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924304140_924304142 -1 Left 924304140 1:242670082-242670104 CCAAGTTCATATTTTTGTTTCCA No data
Right 924304142 1:242670104-242670126 ATCTAAAAGCTAGTTCTGTTTGG No data
924304138_924304142 22 Left 924304138 1:242670059-242670081 CCTATTACCTAAAAATGTGTTTT No data
Right 924304142 1:242670104-242670126 ATCTAAAAGCTAGTTCTGTTTGG No data
924304139_924304142 15 Left 924304139 1:242670066-242670088 CCTAAAAATGTGTTTTCCAAGTT No data
Right 924304142 1:242670104-242670126 ATCTAAAAGCTAGTTCTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924304142 Original CRISPR ATCTAAAAGCTAGTTCTGTT TGG Intergenic
No off target data available for this crispr