ID: 924312006

View in Genome Browser
Species Human (GRCh38)
Location 1:242753753-242753775
Sequence ATTGATTTACCAGCTAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924312006_924312008 9 Left 924312006 1:242753753-242753775 CCTGTTTTAGCTGGTAAATCAAT No data
Right 924312008 1:242753785-242753807 GGCAGCTTGTTAATTATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924312006 Original CRISPR ATTGATTTACCAGCTAAAAC AGG (reversed) Intergenic
No off target data available for this crispr