ID: 924318681

View in Genome Browser
Species Human (GRCh38)
Location 1:242825180-242825202
Sequence CACACTCATGTCAATCCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924318681_924318687 5 Left 924318681 1:242825180-242825202 CCTCCAGGATTGACATGAGTGTG No data
Right 924318687 1:242825208-242825230 AGAAGCTGCTGGCAGGCACCAGG No data
924318681_924318691 28 Left 924318681 1:242825180-242825202 CCTCCAGGATTGACATGAGTGTG No data
Right 924318691 1:242825231-242825253 GGAACCTGCTTCAATCCTACAGG No data
924318681_924318685 -2 Left 924318681 1:242825180-242825202 CCTCCAGGATTGACATGAGTGTG No data
Right 924318685 1:242825201-242825223 TGGCTCCAGAAGCTGCTGGCAGG No data
924318681_924318688 6 Left 924318681 1:242825180-242825202 CCTCCAGGATTGACATGAGTGTG No data
Right 924318688 1:242825209-242825231 GAAGCTGCTGGCAGGCACCAGGG No data
924318681_924318684 -6 Left 924318681 1:242825180-242825202 CCTCCAGGATTGACATGAGTGTG No data
Right 924318684 1:242825197-242825219 AGTGTGGCTCCAGAAGCTGCTGG No data
924318681_924318689 7 Left 924318681 1:242825180-242825202 CCTCCAGGATTGACATGAGTGTG No data
Right 924318689 1:242825210-242825232 AAGCTGCTGGCAGGCACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924318681 Original CRISPR CACACTCATGTCAATCCTGG AGG (reversed) Intergenic
No off target data available for this crispr