ID: 924319279

View in Genome Browser
Species Human (GRCh38)
Location 1:242831153-242831175
Sequence AAGATCACACAGGTAGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924319274_924319279 25 Left 924319274 1:242831105-242831127 CCCCATTTTACAGACGAGAAAAT No data
Right 924319279 1:242831153-242831175 AAGATCACACAGGTAGAACATGG No data
924319275_924319279 24 Left 924319275 1:242831106-242831128 CCCATTTTACAGACGAGAAAATT No data
Right 924319279 1:242831153-242831175 AAGATCACACAGGTAGAACATGG No data
924319276_924319279 23 Left 924319276 1:242831107-242831129 CCATTTTACAGACGAGAAAATTG No data
Right 924319279 1:242831153-242831175 AAGATCACACAGGTAGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924319279 Original CRISPR AAGATCACACAGGTAGAACA TGG Intergenic
No off target data available for this crispr