ID: 924321382

View in Genome Browser
Species Human (GRCh38)
Location 1:242854652-242854674
Sequence TTACCACAGCTGATGCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924321382_924321386 5 Left 924321382 1:242854652-242854674 CCAGAGAGCATCAGCTGTGGTAA No data
Right 924321386 1:242854680-242854702 AGAGGAACCGGTGTTAAGCAGGG No data
924321382_924321384 -7 Left 924321382 1:242854652-242854674 CCAGAGAGCATCAGCTGTGGTAA No data
Right 924321384 1:242854668-242854690 GTGGTAATATAGAGAGGAACCGG No data
924321382_924321385 4 Left 924321382 1:242854652-242854674 CCAGAGAGCATCAGCTGTGGTAA No data
Right 924321385 1:242854679-242854701 GAGAGGAACCGGTGTTAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924321382 Original CRISPR TTACCACAGCTGATGCTCTC TGG (reversed) Intergenic
No off target data available for this crispr