ID: 924323763

View in Genome Browser
Species Human (GRCh38)
Location 1:242875078-242875100
Sequence AGGTGTCCCCTGCAATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924323763_924323768 30 Left 924323763 1:242875078-242875100 CCCTCAAATTGCAGGGGACACCT No data
Right 924323768 1:242875131-242875153 CTCCCAACCTTCCCATAGCTAGG No data
924323763_924323765 -4 Left 924323763 1:242875078-242875100 CCCTCAAATTGCAGGGGACACCT No data
Right 924323765 1:242875097-242875119 ACCTCAAGCTCATAGTTTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924323763 Original CRISPR AGGTGTCCCCTGCAATTTGA GGG (reversed) Intergenic
No off target data available for this crispr