ID: 924325414

View in Genome Browser
Species Human (GRCh38)
Location 1:242890371-242890393
Sequence CGAGGCGTTGCCTGACATCG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924325401_924325414 24 Left 924325401 1:242890324-242890346 CCACGGTGCTCCTGCCCCGGTCC 0: 1
1: 1
2: 1
3: 27
4: 262
Right 924325414 1:242890371-242890393 CGAGGCGTTGCCTGACATCGTGG No data
924325399_924325414 30 Left 924325399 1:242890318-242890340 CCAGAGCCACGGTGCTCCTGCCC 0: 1
1: 1
2: 2
3: 30
4: 283
Right 924325414 1:242890371-242890393 CGAGGCGTTGCCTGACATCGTGG No data
924325404_924325414 14 Left 924325404 1:242890334-242890356 CCTGCCCCGGTCCTGGGACTGCG No data
Right 924325414 1:242890371-242890393 CGAGGCGTTGCCTGACATCGTGG No data
924325405_924325414 10 Left 924325405 1:242890338-242890360 CCCCGGTCCTGGGACTGCGAAGA No data
Right 924325414 1:242890371-242890393 CGAGGCGTTGCCTGACATCGTGG No data
924325407_924325414 8 Left 924325407 1:242890340-242890362 CCGGTCCTGGGACTGCGAAGAAC No data
Right 924325414 1:242890371-242890393 CGAGGCGTTGCCTGACATCGTGG No data
924325408_924325414 3 Left 924325408 1:242890345-242890367 CCTGGGACTGCGAAGAACCAGCC No data
Right 924325414 1:242890371-242890393 CGAGGCGTTGCCTGACATCGTGG No data
924325406_924325414 9 Left 924325406 1:242890339-242890361 CCCGGTCCTGGGACTGCGAAGAA No data
Right 924325414 1:242890371-242890393 CGAGGCGTTGCCTGACATCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924325414 Original CRISPR CGAGGCGTTGCCTGACATCG TGG Intergenic
No off target data available for this crispr