ID: 924328679

View in Genome Browser
Species Human (GRCh38)
Location 1:242921214-242921236
Sequence CCTTAGGGAGATGGGTTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924328679_924328691 1 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328691 1:242921238-242921260 GTTCTGGGCTGGGGTTTTTAAGG No data
924328679_924328694 18 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328694 1:242921255-242921277 TTAAGGGAATTATAGAAGGCAGG No data
924328679_924328689 -8 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328689 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
924328679_924328687 -9 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328687 1:242921228-242921250 TCCCTAAGGAGTTCTGGGCTGGG No data
924328679_924328686 -10 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328686 1:242921227-242921249 CTCCCTAAGGAGTTCTGGGCTGG No data
924328679_924328697 25 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328679_924328693 14 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG No data
924328679_924328696 20 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328696 1:242921257-242921279 AAGGGAATTATAGAAGGCAGGGG No data
924328679_924328692 2 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328692 1:242921239-242921261 TTCTGGGCTGGGGTTTTTAAGGG 0: 8
1: 35
2: 65
3: 102
4: 326
924328679_924328695 19 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328695 1:242921256-242921278 TAAGGGAATTATAGAAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924328679 Original CRISPR CCTTAGGGAGATGGGTTTGA GGG (reversed) Intergenic
No off target data available for this crispr