ID: 924328681

View in Genome Browser
Species Human (GRCh38)
Location 1:242921215-242921237
Sequence TCCTTAGGGAGATGGGTTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924328681_924328693 13 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG No data
924328681_924328692 1 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328692 1:242921239-242921261 TTCTGGGCTGGGGTTTTTAAGGG 0: 8
1: 35
2: 65
3: 102
4: 326
924328681_924328694 17 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328694 1:242921255-242921277 TTAAGGGAATTATAGAAGGCAGG No data
924328681_924328689 -9 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328689 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
924328681_924328691 0 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328691 1:242921238-242921260 GTTCTGGGCTGGGGTTTTTAAGG No data
924328681_924328687 -10 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328687 1:242921228-242921250 TCCCTAAGGAGTTCTGGGCTGGG No data
924328681_924328697 24 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328681_924328695 18 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328695 1:242921256-242921278 TAAGGGAATTATAGAAGGCAGGG No data
924328681_924328696 19 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328696 1:242921257-242921279 AAGGGAATTATAGAAGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924328681 Original CRISPR TCCTTAGGGAGATGGGTTTG AGG (reversed) Intergenic
No off target data available for this crispr