ID: 924328682

View in Genome Browser
Species Human (GRCh38)
Location 1:242921222-242921244
Sequence CCAGAACTCCTTAGGGAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924328682_924328697 17 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328682_924328693 6 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG No data
924328682_924328691 -7 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328691 1:242921238-242921260 GTTCTGGGCTGGGGTTTTTAAGG No data
924328682_924328700 27 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328700 1:242921272-242921294 GGCAGGGGCCTGGAAATTTGGGG No data
924328682_924328694 10 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328694 1:242921255-242921277 TTAAGGGAATTATAGAAGGCAGG No data
924328682_924328695 11 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328695 1:242921256-242921278 TAAGGGAATTATAGAAGGCAGGG No data
924328682_924328692 -6 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328692 1:242921239-242921261 TTCTGGGCTGGGGTTTTTAAGGG 0: 8
1: 35
2: 65
3: 102
4: 326
924328682_924328696 12 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328696 1:242921257-242921279 AAGGGAATTATAGAAGGCAGGGG No data
924328682_924328698 25 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328698 1:242921270-242921292 AAGGCAGGGGCCTGGAAATTTGG No data
924328682_924328699 26 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328699 1:242921271-242921293 AGGCAGGGGCCTGGAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924328682 Original CRISPR CCAGAACTCCTTAGGGAGAT GGG (reversed) Intergenic
No off target data available for this crispr