ID: 924328684

View in Genome Browser
Species Human (GRCh38)
Location 1:242921223-242921245
Sequence CCCAGAACTCCTTAGGGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924328684_924328694 9 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328694 1:242921255-242921277 TTAAGGGAATTATAGAAGGCAGG No data
924328684_924328697 16 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328684_924328692 -7 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328692 1:242921239-242921261 TTCTGGGCTGGGGTTTTTAAGGG 0: 8
1: 35
2: 65
3: 102
4: 326
924328684_924328695 10 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328695 1:242921256-242921278 TAAGGGAATTATAGAAGGCAGGG No data
924328684_924328700 26 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328700 1:242921272-242921294 GGCAGGGGCCTGGAAATTTGGGG No data
924328684_924328698 24 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328698 1:242921270-242921292 AAGGCAGGGGCCTGGAAATTTGG No data
924328684_924328699 25 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328699 1:242921271-242921293 AGGCAGGGGCCTGGAAATTTGGG No data
924328684_924328693 5 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG No data
924328684_924328696 11 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328696 1:242921257-242921279 AAGGGAATTATAGAAGGCAGGGG No data
924328684_924328691 -8 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328691 1:242921238-242921260 GTTCTGGGCTGGGGTTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924328684 Original CRISPR CCCAGAACTCCTTAGGGAGA TGG (reversed) Intergenic
No off target data available for this crispr