ID: 924328688

View in Genome Browser
Species Human (GRCh38)
Location 1:242921229-242921251
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924328688_924328695 4 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328695 1:242921256-242921278 TAAGGGAATTATAGAAGGCAGGG No data
924328688_924328699 19 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328699 1:242921271-242921293 AGGCAGGGGCCTGGAAATTTGGG No data
924328688_924328697 10 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328688_924328698 18 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328698 1:242921270-242921292 AAGGCAGGGGCCTGGAAATTTGG No data
924328688_924328696 5 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328696 1:242921257-242921279 AAGGGAATTATAGAAGGCAGGGG No data
924328688_924328700 20 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328700 1:242921272-242921294 GGCAGGGGCCTGGAAATTTGGGG No data
924328688_924328694 3 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328694 1:242921255-242921277 TTAAGGGAATTATAGAAGGCAGG No data
924328688_924328693 -1 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328693 1:242921251-242921273 GTTTTTAAGGGAATTATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924328688 Original CRISPR CCCCAGCCCAGAACTCCTTA GGG (reversed) Intergenic
No off target data available for this crispr