ID: 924328697

View in Genome Browser
Species Human (GRCh38)
Location 1:242921262-242921284
Sequence AATTATAGAAGGCAGGGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924328688_924328697 10 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328682_924328697 17 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328690_924328697 9 Left 924328690 1:242921230-242921252 CCTAAGGAGTTCTGGGCTGGGGT No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328681_924328697 24 Left 924328681 1:242921215-242921237 CCTCAAACCCATCTCCCTAAGGA No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328679_924328697 25 Left 924328679 1:242921214-242921236 CCCTCAAACCCATCTCCCTAAGG No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data
924328684_924328697 16 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328697 1:242921262-242921284 AATTATAGAAGGCAGGGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924328697 Original CRISPR AATTATAGAAGGCAGGGGCC TGG Intergenic
No off target data available for this crispr