ID: 924328700

View in Genome Browser
Species Human (GRCh38)
Location 1:242921272-242921294
Sequence GGCAGGGGCCTGGAAATTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924328682_924328700 27 Left 924328682 1:242921222-242921244 CCCATCTCCCTAAGGAGTTCTGG No data
Right 924328700 1:242921272-242921294 GGCAGGGGCCTGGAAATTTGGGG No data
924328690_924328700 19 Left 924328690 1:242921230-242921252 CCTAAGGAGTTCTGGGCTGGGGT No data
Right 924328700 1:242921272-242921294 GGCAGGGGCCTGGAAATTTGGGG No data
924328688_924328700 20 Left 924328688 1:242921229-242921251 CCCTAAGGAGTTCTGGGCTGGGG No data
Right 924328700 1:242921272-242921294 GGCAGGGGCCTGGAAATTTGGGG No data
924328684_924328700 26 Left 924328684 1:242921223-242921245 CCATCTCCCTAAGGAGTTCTGGG No data
Right 924328700 1:242921272-242921294 GGCAGGGGCCTGGAAATTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924328700 Original CRISPR GGCAGGGGCCTGGAAATTTG GGG Intergenic
No off target data available for this crispr