ID: 924334934

View in Genome Browser
Species Human (GRCh38)
Location 1:242978126-242978148
Sequence CACCACCAAAAGATGTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924334934_924334937 5 Left 924334934 1:242978126-242978148 CCCCAAAACATCTTTTGGTGGTG No data
Right 924334937 1:242978154-242978176 TTCTAACCAGAATGCAATTAAGG No data
924334934_924334939 17 Left 924334934 1:242978126-242978148 CCCCAAAACATCTTTTGGTGGTG No data
Right 924334939 1:242978166-242978188 TGCAATTAAGGTTTACACATTGG No data
924334934_924334940 23 Left 924334934 1:242978126-242978148 CCCCAAAACATCTTTTGGTGGTG No data
Right 924334940 1:242978172-242978194 TAAGGTTTACACATTGGATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924334934 Original CRISPR CACCACCAAAAGATGTTTTG GGG (reversed) Intergenic
No off target data available for this crispr