ID: 924334937

View in Genome Browser
Species Human (GRCh38)
Location 1:242978154-242978176
Sequence TTCTAACCAGAATGCAATTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924334934_924334937 5 Left 924334934 1:242978126-242978148 CCCCAAAACATCTTTTGGTGGTG No data
Right 924334937 1:242978154-242978176 TTCTAACCAGAATGCAATTAAGG No data
924334936_924334937 3 Left 924334936 1:242978128-242978150 CCAAAACATCTTTTGGTGGTGTT No data
Right 924334937 1:242978154-242978176 TTCTAACCAGAATGCAATTAAGG No data
924334935_924334937 4 Left 924334935 1:242978127-242978149 CCCAAAACATCTTTTGGTGGTGT No data
Right 924334937 1:242978154-242978176 TTCTAACCAGAATGCAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924334937 Original CRISPR TTCTAACCAGAATGCAATTA AGG Intergenic
No off target data available for this crispr