ID: 924334939

View in Genome Browser
Species Human (GRCh38)
Location 1:242978166-242978188
Sequence TGCAATTAAGGTTTACACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924334936_924334939 15 Left 924334936 1:242978128-242978150 CCAAAACATCTTTTGGTGGTGTT No data
Right 924334939 1:242978166-242978188 TGCAATTAAGGTTTACACATTGG No data
924334934_924334939 17 Left 924334934 1:242978126-242978148 CCCCAAAACATCTTTTGGTGGTG No data
Right 924334939 1:242978166-242978188 TGCAATTAAGGTTTACACATTGG No data
924334935_924334939 16 Left 924334935 1:242978127-242978149 CCCAAAACATCTTTTGGTGGTGT No data
Right 924334939 1:242978166-242978188 TGCAATTAAGGTTTACACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924334939 Original CRISPR TGCAATTAAGGTTTACACAT TGG Intergenic
No off target data available for this crispr