ID: 924339011

View in Genome Browser
Species Human (GRCh38)
Location 1:243010991-243011013
Sequence ATGGCTCCACACTGCCATCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
924339006_924339011 15 Left 924339006 1:243010953-243010975 CCCACAGCCGACTGCTGGGTGCG No data
Right 924339011 1:243010991-243011013 ATGGCTCCACACTGCCATCTTGG No data
924339008_924339011 8 Left 924339008 1:243010960-243010982 CCGACTGCTGGGTGCGCAGCAGA No data
Right 924339011 1:243010991-243011013 ATGGCTCCACACTGCCATCTTGG No data
924339007_924339011 14 Left 924339007 1:243010954-243010976 CCACAGCCGACTGCTGGGTGCGC No data
Right 924339011 1:243010991-243011013 ATGGCTCCACACTGCCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
924339011 Original CRISPR ATGGCTCCACACTGCCATCT TGG Intergenic
No off target data available for this crispr